Latest revision as of 22:42, 27 October 2010

miBricks - Parts submitted to the registry

The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels.

First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the Virobytes Assembly protocol we develop.

On RNA level we provide the miTuner toolkit consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The pSMB_miMeasure binding site characterization standard and two pSMB_miTuner expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.

Main Measurement Constructs - Engineered


ID	Content	Registry link	Name
K3	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]	pSMB_miTuner Plasmid HD3
K4	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]	pSMB_miTuner Plasmid HD4
miM	sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)	[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]	pSMB_miMeasure

Synthetic Single Binding Sites

(Physical DNA not submitted)
Design	Content	Registry link	Name
KD:97%	perfect binding site	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]	shRNA miRhaat
KD:69%	imperfect binding site: point mut 11	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]	shRNA miRhaat
KD:28%	imperfect binding site: bulge 16-18	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]	shRNA miRhaat
KD:96%	perfect binding site	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]	miR122
KD:64%	imperfect binding site:	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]	miR122
KD:24%	imperfect binding site:	[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]	miR122

synthetic microRNA binding Site patterns against endogenous miRNA


ID	Content	Registry link
1.3	hsa-miR-122 Binding site pattern (3BS)	[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]
1A	hsa-miR-122 Binding site pattern (4BS)	[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]
1-5	hsa-miR-122 Binding site pattern (2BS)	[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]
3.7	hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)	[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]
1.5	hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12	[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]
1.8	hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12	[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]
3.1	hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12	[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]
4.5	hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12	[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]
4.6	hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12	[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]
mir221-10L2	hsa-miR-221 Binding site pattern (2BS)	[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]

miTunig Kit - Basic Parts


ID	Content	Registry link	Comment
F1	RSV fw	[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]	-
F2	SV40 rc	[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]	-
F3	RSV rc	[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]	-
F4	BGH fw	[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]	-
F5	BGH rc	[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]	leads to insertion of BamHI site
F7	microRNA 10HD	[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]	template for creation of shRNA-like miRNA
F8	CMV fw	[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]	-
F9	FRT site	[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]	-
F10	hRluc	[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]	-
F16	TetR	[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]	-
F17	Luc2	[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]	compatible for insertion of microRNA binding sites
biCMV	biCMV	[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]	-

↑

miTuning Kit - Intermediate Parts 1


ID	Content	Registry link	Purpose of the cassette
F6	luc2_sv40ter	[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]	Luc2 reporter gene with terminator referring to SV40 promoter
F15	CMV_TetO2	[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]	CMV promoter under control of Tet Operator for regulation of gene expression
R1	Sv40(rc)/RSV(fw)	[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]	bidirectional hybrid promoter
R2	Sv40(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]
R3	RSV(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]
R4	RSV(rc)/CMV_TetO2(fw)	[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]
R5	BGH(rc)/shRNA10(rc)	[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]	synthetic microRNA template part
R13	BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)	[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]	tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA
R14	BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337021 BBa_K337021]
R15	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]
R16	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)	[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]
R17	BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)	[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]
R18	BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]
R19	BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]
R20	BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)	[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]	tuning construct core containing Tet Operator for On-Targeting together with repressor construct
R21	Luc2(rc)_sv40(rc)/CMV(fw)	[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]	bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter
R22	Luc2(rc)_sv40(rc)/RSV(fw)	[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]
R32	Kozag_hRluc/BGH(fw)	[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]	reference reporter
R33	TetR_mut(XhoI/XbaI)	[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]	mutagenized TetR including cutting sites to paste miRNA binding sites
T1	BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)	[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]	repressor construct for On-Targeting together with tuning construct
T2	BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)	[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]

miTuning Kit - Intermediate Parts 2


ID	Content	Registry link	Name
K1	BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]	pSMB_miTuner Plasmid HD1
K2	BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]	pSMB_miTuner Plasmid HD2
K5	BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]	pSMB_miTuner Plasmid HD5
K6	BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]	pSMB_miTuner Plasmid HD6
K7	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]	pSMB_miTuner Plasmid HD7
K8	BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH	[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]	pSMB_miTuner Plasmid HD8

ViroBytes

These parts are not submitted in the standardized form.


ID	Part name	Registry link	Description
1	Fragment 1 of wt AAV1	[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]	flanked with Bsa1 sites at both ends
2	Fragment 2 of wt AAV1	[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]	flanked with Bsa1 sites at both ends
3	Fragment 3 of wt AAV1	[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]	flanked with Bsa1 sites at both ends
4	Fragment 4 of wt AAV1	[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]	flanked with Bsa1 sites at both ends
5	Fragment 5 of wt AAV1	[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]	flanked with Bsa1 sites at both ends
6	Fragment 6 of wt AAV1	[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]	flanked with Bsa1 sites at both ends
7	Fragment 7 of wt AAV1	[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]	flanked with Bsa1 sites at both ends
8	Fragment 8 of wt AAV1	[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]	flanked with Bsa1 sites at both ends
9	Fragment 1 of wt AAV2	[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]	flanked with Bsa1 sites at both ends
10	Fragment 2 of wt AAV2	[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]	flanked with Bsa1 sites at both ends
11	Fragment 3 of wt AAV2	[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]	flanked with Bsa1 sites at both ends
12	Fragment 4 of wt AAV2	[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]	flanked with Bsa1 sites at both ends
13	Fragment 5 of wt AAV2	[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]	flanked with Bsa1 sites at both ends
14	Fragment 6 of wt AAV2	[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]	flanked with Bsa1 sites at both ends
15	Fragment 7 of wt AAV2	[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]	flanked with Bsa1 sites at both ends
16	Fragment 8 of wt AAV2	[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]	flanked with Bsa1 sites at both ends
17	Fragment 1 of wt AAV5	[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]	flanked with Bsa1 sites at both ends
18	Fragment 2 of wt AAV5	[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]	flanked with Bsa1 sites at both ends
19	Fragment 3 of wt AAV5	[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]	flanked with Bsa1 sites at both ends
20	Fragment 4 of wt AAV5	[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]	flanked with Bsa1 sites at both ends
21	Fragment 5 of wt AAV5	[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]	flanked with Bsa1 sites at both ends
22	Fragment 6 of wt AAV5	[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]	flanked with Bsa1 sites at both ends
23	Fragment 7 of wt AAV5	[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]	flanked with Bsa1 sites at both ends
24	Fragment 8 of wt AAV5	[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]	flanked with Bsa1 sites at both ends
25	Fragment 1 of wt AAV6	[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]	flanked with Bsa1 sites at both ends
26	Fragment 2 of wt AAV6	[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]	flanked with Bsa1 sites at both ends
27	Fragment 3 of wt AAV6	[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]	flanked with Bsa1 sites at both ends
28	Fragment 4 of wt AAV6	[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]	flanked with Bsa1 sites at both ends
29	Fragment 5 of wt AAV6	[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]	flanked with Bsa1 sites at both ends
30	Fragment 6 of wt AAV6	[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]	flanked with Bsa1 sites at both ends
31	Fragment 7 of wt AAV6	[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]	flanked with Bsa1 sites at both ends
32	Fragment 8 of wt AAV6	[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]	flanked with Bsa1 sites at both ends
33	Fragment 1 of wt AAV8	[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]	flanked with Bsa1 sites at both ends
34	Fragment 2 of wt AAV8	[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]	flanked with Bsa1 sites at both ends
35	Fragment 3 of wt AAV8	[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]	flanked with Bsa1 sites at both ends
36	Fragment 4 of wt AAV8	[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]	flanked with Bsa1 sites at both ends
37	Fragment 5 of wt AAV8	[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]	flanked with Bsa1 sites at both ends
38	Fragment 6 of wt AAV8	[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]	flanked with Bsa1 sites at both ends
39	Fragment 7 of wt AAV8	[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]	flanked with Bsa1 sites at both ends
40	Fragment 8 of wt AAV8	[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]	flanked with Bsa1 sites at both ends
41	Fragment 1 of wt AAV9	[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]	flanked with Bsa1 sites at both ends
42	Fragment 2 of wt AAV9	[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]	flanked with Bsa1 sites at both ends
43	Fragment 3 of wt AAV9	[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]	flanked with Bsa1 sites at both ends
44	Fragment 4 of wt AAV9	[http://partsregistry.org/Part:BBa_K337101 BBa_K337101]	flanked with Bsa1 sites at both ends
45	Fragment 5 of wt AAV9	[http://partsregistry.org/Part:BBa_K337102 BBa_K337102]	flanked with Bsa1 sites at both ends
46	Fragment 6 of wt AAV9	[http://partsregistry.org/Part:BBa_K337103 BBa_K337103]	flanked with Bsa1 sites at both ends
47	Fragment 7 of wt AAV9	[http://partsregistry.org/Part:BBa_K337104 BBa_K337104]	flanked with Bsa1 sites at both ends
48	Fragment 8 of wt AAV9	[http://partsregistry.org/Part:BBa_K337105 BBa_K337105]	flanked with Bsa1 sites at both ends

↑

@@ Line 1: / Line 1: @@
-{{:Team:Heidelberg/Template}}
+{{:Team:Heidelberg/Single}}
+{{:Team:Heidelberg/Single_Pagetop|parts}}
 <html>
@@ Line 12: / Line 12: @@
 switch (d.getElementsByTagName("thead")[0]) {
-case undefined:
+	case undefined:
-setTimeout("start()",200);
+		setTimeout("start()",200);
-break;
+		break;
-default:
+	default:
-formatparts();
+	formatparts();
-break;
+	break;
 }
 }
 function formatparts() {
-var d = document.getElementById("groupparts")
+var d = document.getElementById("groupparts");
-var dbodytr = d.getElementsByTagName("tbody")[0]
+var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");
+var lasttd = dbodytr[0].getElementsByTagName("td").length;
-var lasttd = dbodytr.getElementsByTagName("tr")[0].childNodes.length;
+var designertd = lasttd - 2;
+var rowscount = dbodytr.length
-var designertd = lasttd - 3;
-var rowscount = dbodytr.getElementsByTagName("tr").length
 d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"
 for (var i=0;i<rowscount;i++) {
+	dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"
-dbodytr.getElementsByTagName("tr")[i].childNodes[designertd].style.display ="none"
 }
@@ Line 47: / Line 41: @@
 {{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}
 <html>
 <body onload="start()">
 </html>
+__NOTOC__
+=miBricks - Parts submitted to the registry=
+<br>
-{{:Team:Heidelberg/Pagetop|parts}}
+The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels.
-==Parts==
-<groupparts>iGEM010 Heidelberg</groupparts>
+First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.
-==Primer Table==
+On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
-!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
+==Main Measurement Constructs - Engineered==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
+|+ align="top, left"|
+|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name
 |-
-|align="right"| 001 || Casp8FWEcoR1 || ttttgaattcatggacttcagcagaaatc || Caspase8 death gene || Caspase8 ||
+|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3
 |-
-|align="right"| 002 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || CMV, shRNA || pcDNA5/FRT-shRNA || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
+|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4
 |-
-|align="right"| 003 || CMVshRNApA_BglII_rv || taatagatctcagaagccatagagcccacc || CMV, shRNA || pcDNA5/FRT-shRNA || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
+|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure
 |-
-|align="right"| 004 || EGFPRVFse1 || ttttggccggcccttgtacagctcgtccatg || EGFP || GFP ||
-|-
-|align="right"| 005 || ElenasFirstSyntheticRNA_F || aatatgtctaaactattatttatgccaaccagccaatctagctactgctaggc || part 2 Elenas first synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 006 || ElenasFirstSyntheticRNA_R || aataatagtttagacatatttatgccagccagccagaccagctctgctaagg || part 3 Elenas first synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 007 || ElenasSecondSyntheticRNA_F || gacatgtctaaactattgtcttcggtagcgtcgtagactagctactgctaggc || part 2 Elenas second synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 008 || ElenasSecondSyntheticRNA_R || gacaatagtttagacatgtcttcggtatcgtcgtatcccagctctgctaagg || part 3 Elenas second synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 009 || ElenasThirdSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas third synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 010 || ElenasThirdSyntheticRNA_R || tattatagtttagacaaataattcgcgtctggccttcccagctctgctaagg || part 3 Elenas third synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 011 || ElenasFifthSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 012 || ElenasFifthSyntheticRNA_R || atctatagtttagacaagatgaaacgccgagttaacgccagctctgctaagg || part 3 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 013 || ElenasSixthSyntheticRNA_F || ttattgtctaaactatataactgccgtaactccaaatctagctactgctaggc || part 2 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 014 || ElenasSixthSyntheticRNA_R || ttatatagtttagacaataactgccgtcactccaacgccagctctgctaagg || part 3 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 015 || ElenasSeventhSyntheticRNA_F || atcttgtctaaactatagataactgccatcactccccctagctactgctaggc || part 2 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 016 || ElenasSeventhSyntheticRNA_R || atctatagtttagacaagataactgccgtcactccaaccagctctgctaagg || part 3 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 017 || ElenasEighthSyntheticRNA_F || tacatgtctaaactattgtagtcggttcatgcagcccctagctactgctaggc || part 2 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 018 || ElenasEighthSyntheticRNA_R || tacaatagtttagacatgtagtcggtttatgcagcaaccagctctgctaagg || part 3 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 019 || ElenasNinethSyntheticRNA_F || aaattgtctaaactatatttgatccagagatacagaactagctactgctaggc || part 2 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 020 || ElenasNinethSyntheticRNA_R || aaatatagtttagacaatttgatccagcgatacagcgccagctctgctaagg || part 3 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 021 || ElenasTenthSyntheticRNA_F || attatgtctaaactattaatatcggtgaccgtggtacctagctactgctaggc || part 2 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 022 || ElenasTenthSyntheticRNA_R || attaatagtttagacataatatcggtggccgtggtgtccagctctgctaagg || part 3 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5
-|-
-|align="right"| 023 || FADDFWEcoR1 || ttttgaattcatgggcggtaggcgtgtacg || FADD ||  ||
-|-
-|align="right"| 024 || gE1A-Fse1_rev || tttttccggccggttatggcctggggcctttaca || E1A rescue gene ||  ||
-|-
-|align="right"| 025 || Hcrfor_HindIII_AgeI_TL || gagtcaagcttaccggttggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: HindIII, AgeI || miRsAg || pC-DNA5
-|-
-|align="right"| 026 || Hcrrev_ApaI_SalI_TL || ctcgagggcccgtcgacaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: ApaI, SalI || miRsAg || pC-DNA5
-|-
-|align="right"| 027 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
-|-
-|align="right"| 028 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
-|-
-|align="right"| 029 || Kif11_PLK1_shRNA-hcrfor:ecoRI || gagtcgaattctggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: ecoRI || miRsAg || pTR-UF3
-|-
-|align="right"| 030 || Kif11&PLK1_shRNA_hcrrev:XbaI || ctcgaagatctaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: XbaI || miRsAg || pTR-UF3
-|-
-|align="right"| 031 || Kif11_shRNA_forward || actctgtctaaactatgagtacattaaacaattcctattagctactgctaggc || part 2 shRNA against Kif11 || miRsAg || pTR-UF3
-|-
-|align="right"| 032 || Kif11_shRNA_reverse || actcatagtttagacagagtacattaatcaattccattcagctctgctaagg || part3 shRNA against Kif11 || miRsAg || pTR-UF3
-|-
-|align="right"| 033 || PLK1_shRNA_forward || atgatgtctaaactattcattaagcagatcgttaaccgtagctactgctaggc || part2 shRNA against PLK1|| miRsAg || pTR-UF3
-|-
-|align="right"| 034 || PLK1_shRNA_reverse || atgaatagtttagacatcattaagcagctcgttaatggcagctctgctaagg || part3 shRNA against PLK1|| miRsAg || pTR-UF3
-|-
-|align="right"| 035 || pTR-UF3_Nsp1_for || ctattacgccagctggatgcatcccagctgc || for pTR-UF3 backbone Pst1->Nsi1 mutation || ||
-|-
-|align="right"| 036 || pTR-UF3_Nsp1_rev || gcagctgggatgcatccagctggcgtaatag || for pTR-UF3 backbone Pst1->Nsi1 mutation || ||
-|-
-|align="right"| 037 || pTR-UF3_PstI-NsiI_for || gctattacgccagctggatgcatcccagctgcattaatgaatcgg || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
-|-
-|align="right"| 038 || pTR-UF3_PstI-NsiI_rev || ccgattcattaatgcagctgggatgcatccagctggcgtaatagc || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
-|-
-|align="right"| 039 || pTR-UF3_PstI-NsiI_shifted_rev || cattaatgcagctgggatgcatccagctggcgtaatagcgaagag || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
-|-
-|align="right"| 040 || pTRUF3_seq_fwrv || caactccatcactaggggttcct || sequencing purpose || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]] || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
-|-
-|align="right"| 041 || SCLpsv40_FW || ctcaattagtcagcaaccatagtccc || FWprimer for testing stable integration of shRNA into T-Rex ||  || T-REx cells
-|-
-|align="right"| 042 || SCLpsv40_FW || gcaaagtgccgataaacataacgatct || RVprimer for testing stable integration of shRNA into T-Rex ||  || T-REx cells
-|-
-|align="right"| 043 || Sequencing primer_pTR-UF3 mutated || ctaaatcggaaccctaaagggagcccccg || sequencing of mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
-|-
-|align="right"| 044 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
-|-
-|align="right"| 045 || Sv40lucmcs_BglII_rv || tattagatctccgcgtcagacaaaccctaac || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
-|-
-|align="right"| 046 || tBidGFPRVFse1 || tttttggccggccttacatgtacagctcg || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]]
-|-
-|align="right"| 047 || tBidFWEcoR1 || tttttgaattcaaccgcagcagccactc || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]]
-|-
-|align="right"| 048 || tBidRVFse1 || tttttccggccgggtccatcccatttctg || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]]
-|-
-|align="right"| 049 || TetO2FW || ggggacaacttttctatacaaagttgtccctatcagtgatagagatctc || TetO8 || synthesized tetO8 || Gateway entry vector
 |}
+</center>
+==Synthetic Single Binding Sites==
-==Standart Kit Cloning Primers==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
+|+ align="top, left"|(Physical DNA not submitted)
-!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
+|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name
 |-
-|align="right"| D001 || backbone_AvrII_fw || ttttcctaggtagcggcgcattaagcgcgg || -|| - | - || - | -
+|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat
 |-
-|align="right"| D002 || backbone_AvrII_rev || ttttcctaggcttgttgtagcttaaattttg  || -|| - | - || - | -
+|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat
 |-
-|align="right"| D003 || backbone_ClaI_fw || ttttatcgattagcggcgcattaagcgcgg  || -|| - | - || - | -
+|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat
 |-
-|align="right"| D004 ||  backbone_XhoI_rev || ttttctcgagcttgttgtagcttaaattttg  || -|| - | - || - | -
+|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122
 |-
-|align="right"| D005 || BBB_Oligo_XhoI || ccggActgcagcggccgcgcgctagcacactagtgcggccgcgaattCa  || -|| - | - || - | -
+|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122
 |-
-|align="right"| D006 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt  || -|| - | - || - | -
+|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122
 |-
-|align="right"| D007 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt  || -|| - | - || - | -
-|-
-|align="right"| D008 || BBB_suffix_reverse || aaaactgcagcggccgcgc || -|| - | - || - | -
-|-
-|align="right"| D009 || BGH_pA_BamHI_rc_fw || ttttgaattcgcggccgcactagtggatccccatagagcccaccgcatccc || -|| - | - || - | -
-|-
-|align="right"| D010 || BGH_pA_fw || ttttgaattcgcggccgcactagttttaaacccgctgatcagcc  || -|| - | - || - | -
-|-
-|align="right"| D011 || BGH_pA_rev || ttttctgcagcggccgcgctagcccatagagcccaccgcatccc  || -|| - | - || - | -
-|-
-|align="right"| D012 || BGH_pA_rc_rev || ttttctgcagcggccgcgctagctttaaacccgctgatcagcc || -|| - | - || - | -
-|-
-|align="right"| D013 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg || -|| - | - || - | -
-|-
-|align="right"| D014 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg || -|| - | - || - | -
-|-
-|align="right"| D015 || biCMV_BBB_rev || ttttctgcagcggccgcgcgctagcacagcggatctgacggttcac || -|| - | - || - | -
-|-
-|align="right"| D016 || biCMV_rc_BBB_fw || ttttgaattcgcggccgcactagtagcggatctgacggttcac || -|| - | - || - | -
-|-
-|align="right"| D017 || biCMV_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgatctgacggttcac || -|| - | - || - | -
-|-
-|align="right"| D018 || CMV_BBB_BamHI_fw || gaattcgcggccgcactagtggatcccgatgtacgggccagatatacg  || -|| - | - || - | -
-|-
-|align="right"| D019 || CMV_BBB_fw || ttttgaattcgcggccgcactagtcgatgtacgggccagatatacg || -|| - | - || - | -
-|-
-|align="right"| D020 || CMV_BBB_rev || ttttctgcagcggccgcgcgctagcacatttcgataagccagtaagc || -|| - | - || - | -
-|-
-|align="right"| D021 || CMV_Teto2_BBB_fw || tttt gaattcgcggccgcactagtgttgacattgattattgtctag || -|| - | - || - | -
-|-
-|align="right"| D022 || CMV_TetO2_BBB_rev || tttt ctgcagcggccgcgcgctagcaccggaggctggatcggtc || -|| - | - || - | -
-|-
-|align="right"| D023 || CMV_rc_BBB_fw || ttttgaattcgcggccgcactagtatttcgataagccagtaagc  || -|| - | - || - | -
-|-
-|align="right"| D024 || CMV_rc_BBB_rev || ttttctgcagcggccgcgctagccgatgtacgggccagatatacg  || -|| - | - || - | -
-|-
-|align="right"| D025 || FRT_rev || ctgcagcggccgcgctagcccaaggaagttcctatactttc || -|| - | - || - | -
-|-
-|align="right"| D026 || FRT_rev || gaattcgcggccgcactagtttctcgccacgttcgccggc || -|| - | - || - | -
-|-
-|align="right"| D027 || hRluc_ter_BBB_fw || ttttgaattcgcggccgcactagtatggcttccaaggtgtacgac || -|| - | - || - | -
-|-
-|align="right"| D028 || hRluc_ter_BBB_rev || ttttctgcagcggccgcgctagcttactgctcgttcttcagcacgc || -|| - | - || - | -
-|-
-|align="right"| D029 || hsa-mir-122_BBB(perf) || ttttgaattcgcggccgcactagtcaaacaccattgtcacactccagctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D030 || hsa-mir-122_BBB(rand9-12) || ttttgaattcgcggccgcactagtcaaacaccatnnnnacactccagctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D031 || hsa-mir-122_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnacactccagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D032 || hsa-mir-122_Sgf_Not(perf) || ttttgcgatcgccaaacaccattgtcacactccagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D033 || hsa-mir-122_Sgf_Not(rand9-12) || ttttgcgatcgccaaacaccatnnnnacactccagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D034 || hsa-mir-122_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnnacactccagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D035 || hsa-mir-375_BBB(perf) || ttttgaattcgcggccgcactagttcacgcgagccgaacgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D036 || hsa-mir-375_BBB(rand9-12) || ttttgaattcgcggccgcactagttcacgcgagcnnnncgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D037 || hsa-mir-375_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D038 || hsa-mir-375_Sgf_Not(perf) || ttttgcgatcgctcacgcgagccgaacgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D039 || hsa-mir-375_Sgf_Not(rand9-12) || ttttgcgatcgctcacgcgagcnnnncgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D040 || hsa-mir-375_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnncgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D041 || hsa-mir-376a_BBB(perf) || ttttgaattcgcggccgcactagtacgtggattttcctctatgatgctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D042 || hsa-mir-376a_BBB(rand9-12) || ttttgaattcgcggccgcactagtacgtggattnnnntctatgatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D043 || hsa-mir-376a_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnntctatgatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D044 || hsa-mir-376a_Sgf_Not(perf) || ttttgcgatcgcacgtggattttcctctatgatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D045 || hsa-mir-376a_Sgf_Not(rand9-12) || ttttgcgatcgcacgtggattnnnntctatgatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D046 || hsa-mir-376a_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnntctatgatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D047 || igem20100723_01 || tgccacctgacgtctaagaa  || -|| - | - || - | -
-|-
-|align="right"| D048 || igem20100723_02 || attaccgcctttgagtgagc  || -|| - | - || - | -
-|-
-|align="right"| D049 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac || -|| - | - || - | -
-|-
-|align="right"| D050 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac || -|| - | - || - | -
-|-
-|align="right"| D051 || Luc2_ter_BBB_fw || ttttgaattcgcggccgcactagtgccaccatggaagatgcc || -|| - | - || - | -
-|-
-|align="right"| D052 || mir122_miMeasure_screen_fev || ccgcgctagctggagtgt || -|| - | - || - | -
-|-
-|align="right"| D053 || Oligo_Xba_mut_fw || ctagcctcgagttctgaccgccccgggg || -|| - | - || - | -
-|-
-|align="right"| D054 || Oligo_Xba_mut_rev || ctagccccggggcggtcagaactcgagg  || -|| - | - || - | -
-|-
-|align="right"| D055 || pSMB_miMeasure_Screen_fw || gcacaagctggagtacaactac || -|| - | - || - | -
-|-
-|align="right"| D056 || pSMB_miMeasure_Screen_rev || ggtttcccgactggaaagcg || -|| - | - || - | -
-|-
-|align="right"| D057 || RSV_fw || ttttgaattcgcggccgcactagtcaattctcatgtttgacagc || -|| - | - || - | -
-|-
-|align="right"| D058 || RSV_rev || ttttctgcagcggccgcgctagccagcttggaggtgcacacc || -|| - | - || - | -
-|-
-|align="right"| D059 || RSV_rc_fw || ttttgaattcgcggccgcactagtcagcttggaggtgcacacc || -|| - | - || - | -
-|-
-|align="right"| D060 || RSV_rc_rev || ttttctgcagcggccgcgctagccaattctcatgtttgacagc || -|| - | - || - | -
-|-
-|align="right"| D061 || RSV_fw_midcomp || cgaaccactgaataccgcattgcag || -|| - | - || - | -
-|-
-|align="right"| D062 || RSV_rev_midcomp || ctgcaatgcggtattcagtggttcg || -|| - | - || - | -
-|-
-|align="right"| D063 || SB-prep-3P || gccgctgcagtccggcaaaaaaacg || -|| - | - || - | -
-|-
-|align="right"| D064 || SB-prep-2Ea || atgaattccagaaatcatccttagcg || -|| - | - || - | -
-|-
-|align="right"| D065 || second_strand_notI || agttgtgacatagcggccgc || -|| - | - || - | -
-|-
-|align="right"| D066 || shRNA-6th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgtcaatagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D067 || shRNA-7th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnntcaatagagctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D068 || shRNA-8th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctgatgtgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D069 || shRNA-9th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnctagtttagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D070 || shRNA-10th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctataatgctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D071 || shRNA-6th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcaacctcactgccgtcaatagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D072 || shRNA-7th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacctcactgccgtcaatagagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D073 || shRNA-8th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacgacgtatttggctgatgtgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D074 || shRNA-9th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcgacatagcgacctagtttagctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D075 || shRNA-10th-bs(perf)_BBB || ttttgaattcgcggccgcactagtctgtggtgccggtggctataatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D076 || shRNA-6th-bs(rand9-12)_BBB || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D077 || shRNA-7th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacctcactnnnntcaatagagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D078 || shRNA-8th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacgacgtannnngctgatgtgctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D079 || shRNA-9th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcgcgacatagnnnnctagtttagctagcgcggccgctgcagtttt || -|| - | - || - | -
-|-
-|align="right"| D080 || shRNA-10th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtctgtggtgccnnnngctataatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
-|-
-|align="right"| D081 || shRNA-6th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D082 || shRNA-7th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnntcaatagagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D083 || shRNA-8th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D084 || shRNA-9th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnnctagtttagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D085 || shRNA-10th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctataatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D086 || shRNA-6th-bs(perf)_SgfI_NotI || gcgatcgccgcaacctcactgccgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D087 || shRNA-7th-bs(perf)_SgfI_NotI || gcgatcgccaacctcactgccgtcaatagagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D088 || shRNA-8th-bs(perf)_SgfI_NotI || gcgatcgccaacgacgtatttggctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D089 || shRNA-9th-bs(perf)_SgfI_NotI || gcgatcgccgcgacatagcgacctagtttagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D090 || shRNA-10th-bs(perf)_SgfI_NotI || gcgatcgcctgtggtgccggtggctataatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D091 || shRNA-6th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D092 || shRNA-7th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacctcactnnnntcaatagagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D093 || shRNA-8th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacgacgtannnngctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D094 || shRNA-9th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcgacatagnnnnctagtttagcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D095 || shRNA-10th-bs(rand9-12)_SgfI_NotI || gcgatcgcctgtggtgccnnnngctataatgcggccgctatgtcacaact || -|| - | - || - | -
-|-
-|align="right"| D096 || shRNA_AflII_BBB_fw || ttttctgcagcggccgcgcgctagccttaagtggaggtgaagttaacaccttcgtg || -|| - | - || - | -
-|-
-|align="right"| D097 || shRNA_HindIII_BBB_rev || ttttgaattcgcggccgcactagtaagcttaagcaaacgatgccaagacatttatcg || -|| - | - || - | -
-|-
-|align="right"| D098 || SV40_BamHI_BBB_fw || ctgcagcggccgcgctagcggatccaagctttttgcaaaagcctagg  || -|| - | - || - | -
-|-
-|align="right"| D099 || SV40_BBB_rev || ttttctgcagcggccgcgctagcaagctttttgcaaaagcctaggc  || -|| - | - || - | -
-|-
-|align="right"| D100 || SV40_rc_BBB_fw || ttttgaattcgcggccgcactagtaagctttttgcaaaagcc || -|| - | - || - | -
-|-
-|align="right"| D101 || SV40_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgcagcaccatggcctg || -|| - | - || - | -
-|-
-|align="right"| D102 || SV40_term_fw || ttttgaattcgcggccgcactagtcagacatgataagatacattg || -|| - | - || - | -
-|-
-|align="right"| D103 || SV40_Xho_Xma_BBB_fw || gaattcgcggccgcactagtctcgagtttctcccggggcgcagcaccatggcctg  || -|| - | - || - | -
-|-
-|align="right"| D104 || TetRepressor (from pcDNA6)fw || ttttgaattcgcggccgcactagtgccaccatgtctagattagataaaag  || -|| - | - || - | -
-|-
-|align="right"| D105 || TetRepressor (from pcDNA6)rew || ttttctgcagcggccgcgctagcttaataagatctaaattcccgcgatccgc  || -|| - | - || - | -
 |}
+</center>
+==synthetic microRNA binding Site patterns against endogenous miRNA==
+<center>
-==ViroBytes primers==
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
+|+ align="top, left"|
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
+|width=40px|  ID||width=350px|Content||width=100px|Registry link
-!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified fragment !! direction !! cap gene of AAV
 |-
-|align="right"| R001 || Anchor12367891012 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaacTACCG || anchor  || - ||
+|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]
 |-
-|align="right"| R002 || Anchor4 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactactg || anchor  || - ||
+|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]
 |-
-|align="right"| R003 || Anchor5 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactacag || anchor  || - ||
+|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]
 |-
-|align="right"| R004 || Anchor_comp_all || gttaattaacgaatgctagtcactcagacaagctt || anchor  || - ||
+|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]
 |-
-|align="right"| R005 || F1_for_cap12678910 || gctacggtctcaatggctgccgatggttatcttccag || 1  || forward || 1,2,6,7,8,9,10
+|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]
 |-
-|align="right"| R006 || F1_for_cap5 || gctacggtctcaatggctgccgatggttatcttccag || 1  || forward || 5
+|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]
 |-
-|align="right"| R007 || F1_rev_cap2 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1  || reverse || 2
+|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]
 |-
-|align="right"| R008 || F1_rev_cap5 || gctacggtctctctcctgaaactcggcgtccgcgtgg || 1  || reverse || 5
+|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]
 |-
-|align="right"| R009 || F1_rev_cap9 || gctacggtctcgctcctggaactcggcgtcggcgtgg || 1  || reverse || 9
+|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]
 |-
-|align="right"| R010 || F1_rev_cap168 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1  || reverse || 1,6,8
+|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]
 |-
-|align="right"| R011 || F2_for_cap2 || gctacggtctctggagcgccttaaagaagatacgtcttttggggg || 2  || forward || 2
+|}
+</center>
+==miTunig Kit - Basic Parts==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
+|+ align="top, left"|
+|width=40px|  ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment
 |-
-|align="right"| R012 || F2_for_cap5 || gctacggtctctggagaagctcgccgacgacacatccttcggggg || 2  || forward || 5
+|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-
 |-
-|align="right"| R013 || F2_for_cap9 || gctacggtctctggagcggctcaaagaagatacgtcttttggggg || 2  || forward || 9
+|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-
 |-
-|align="right"| R014 || F2_for_cap168 || gctacggtctctggagcgtctgcaagaagatacgtcttttggggg || 2  || forward || 1,6,8
+|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-
 |-
-|align="right"| R015 || F2_rev_cap2 || gctacggtctcgtgtcgcccatccatgtggaatcgcaatgc || 2  || reverse || 2
+|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-
 |-
-|align="right"| R016 || F2_rev_cap5 || gctacggtctcgtgtcccccatccacgtggaatcgcaatgc || 2  || reverse || 5
+|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site
 |-
-|align="right"| R017 || F2_rev_cap9 || gctacggtctcgtgtcccccagccattgggaatcgcaatgc || 2  || reverse || 9
+|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA
 |-
-|align="right"| R018 || F2_rev_cap168 || gctacggtctcgtgtcgcccagccatgtggaatcgcaatgc || 2  || reverse || 1,6,8
+|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-
 |-
-|align="right"| R019 || F3_for_cap5 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 5
+|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-
 |-
-|align="right"| R020 || F3_for_cap9 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 9
+|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-
 |-
-|align="right"| R021 || F3_for_cap1268 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 1,2,6,8
+|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-
 |-
-|align="right"| R022 || F3_rev_cap1 || gctacggtctcaggttattagcgatggttgtgacgccatcattcgtc || 3  || reverse || 1
+|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites
 |-
-|align="right"| R023 || F3_rev_cap2 || gctacggtctcaggttattggcaatcgtcgtcgtaccgtcattctgc || 3  || reverse || 2
+|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-
 |-
-|align="right"| R024 || F3_rev_cap5 || gctacggtctcaggttgttggcgatggtggtggtggagtcctgcac || 3  || reverse || 5
+|}
+</center>
+<html>
+<div class="backtop">
+<a href="#top">&uarr;</a>
+</div>
+</html>
+==miTuning Kit -  Intermediate Parts 1==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
+|+ align="top, left"|
+|width=40px|  ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette
 |-
-|align="right"| R025 || F3_rev_cap6 || gctacggtctcaggttattagcgatggtcgtgacgccatcattcgtc || 3  || reverse || 6
+|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter
 |-
-|align="right"| R026 || F3_rev_cap8 || gctacggtctcaggttattggcgatggtcttggtgccttcattctgc || 3  || reverse || 8
+|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression
 |-
-|align="right"| R027 || F3_rev_cap9 || gctacggtctcaggttattggcgatggtcttgactccattgttgtcc || 3  || reverse || 9
+|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter
 |-
-|align="right"| R028 || F4_for_cap2 || gctacggtctctaaccttaccagcacggttcaggtgtttactgactc || 4  || forward || 2
+|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]
 |-
-|align="right"| R029 || F4_for_cap5 || gctacggtctccaacctcacctccaccgtccaagtgtttacggacga || 4  || forward || 5
+|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]
 |-
-|align="right"| R030 || F4_for_cap8 || gctacggtctctaacctcaccagcaccatccaggtgtttacggactc || 4  || forward || 8
+|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]
 |-
-|align="right"| R031 || F4_for_cap9 || gctacggtctctaaccttaccagcacggtccaggtcttcacggactc || 4  || forward || 9
+|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part
 |-
-|align="right"| R032 || F4_for_cap16 || gctacggtctctaaccttaccagcacggttcaagtcttctcggactc || 4  || forward || 1,6
+|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA
 |-
-|align="right"| R033 || F4_reverse_cap1 || gctacggtctcagctgctgtggaaaggcacttcctcaaaggtg || 4  || reverse || 1
+|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021]
 |-
-|align="right"| R034 || F4_reverse_cap2 || gctacggtctcagctgctgtggaaaggaacgtcctcaaaagtg || 4  || reverse || 2
+|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]
 |-
-|align="right"| R035 || F4_reverse_cap5 || gctacggtctcagctggagtggaagggcacctcctcaaagttg || 4  || reverse || 5
+|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]
 |-
-|align="right"| R036 || F4_reverse_cap9 || gctacggtctcagctgctatggaaaggtacgttctcaaactcg || 4  || reverse || 9
+|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]
 |-
-|align="right"| R037 || F4_reverse_cap68 || gctacggtctcagctgctgtggaaaggcacgtcctcgaaggtg || 4  || reverse || 6,8
+|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]
 |-
-|align="right"| R038 || F5_for_cap2 || gctacggtctcgcagctacgctcacagccagagtctggaccgtc || 5  || forward || 2
+|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]
 |-
-|align="right"| R039 || F5_for_cap5 || gctacggtctcccagcttcgctcccagtcagaacctgttcaagc || 5  || forward || 5
+|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct
 |-
-|align="right"| R040 || F5_for_cap8 || gctacggtctcgcagctacgcccacagccagagcttggaccggc || 5  || forward || 8
+|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter
 |-
-|align="right"| R041 || F5_for_cap9 || gctacggtctcgcagctacgctcacagccaaagcctggaccgac || 5  || forward || 9
+|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]
 |-
-|align="right"| R042 || F5_for_cap16 || gctacggtctcgcagctacgcgcacagccagagcctggaccggc || 5  || forward || 1,6
+|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter
 |-
-|align="right"| R043 || F5_rev_cap2 || gctacggtctccagttcctagactggtcccgaatgtcactcg || 5  || reverse || 2
+|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites
 |-
-|align="right"| R044 || F5_rev_cap5 || gctacggtctccagtttttgtaggtgttggcgtatctcccgg || 5  || reverse || 5
+|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct
 |-
-|align="right"| R045 || F5_rev_cap8 || gctacggtctccagttctttgcctgattggccattgtattag || 5  || reverse || 8
+|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]
 |-
-|align="right"| R046 || F5_rev_cap9 || gctacggtctctagtttcttccctggacagccatgttgctgg || 5  || reverse || 9
-|-
-|align="right"| R047 || F5_rev_cap16 || gctacggtctccagtttttgggctgaacagacatgccagctg || 5  || reverse || 1,6
-|-
-|align="right"| R048 || F6_for_cap2 || gctacggtctcgaactggcttcctggaccctgttaccgccagc || 6 || forward || 2
-|-
-|align="right"| R049 || F6_for_cap5|| gctacggtctcaaactggttcccggggcccatgggccgaaccc || 6 || forward || 5
-|-
-|align="right"| R050 || F6_for_cap8 || gctacggtctcgaactggctgccaggaccctgttaccgccaac || 6 || forward || 8
-|-
-|align="right"| R051 || F6_for_cap9 || gctacggtctcaaactacatacctggacccagctaccgacaac || 6 || forward || 9
-|-
-|align="right"| R052 || F6_for_cap16 || gctacggtctcaaactggctacctggaccctgttatcggcagc || 6 || forward || 1,6
-|-
-|align="right"| R053 || F6_rev_cap1 || gctacggtctcgccacagggttagtggctttaatttcctcttcgtctg || 6 || reverse || 1
-|-
-|align="right"| R054 || F6_rev_cap2 || gctacggtctcgccacgggattggttgtcctgatttcctcttcgtctg || 6 || reverse || 2
-|-
-|align="right"| R055 || F6_rev_cap5 || gctacggtctcgccacgcggttcaccggctgcgtctcgctctcgctgg || 6 || reverse || 5
-|-
-|align="right"| R056 || F6_rev_cap6 || gctacggtctcgccacggggttagtggctttgatttcctcttcgtctg || 6 || reverse || 6
-|-
-|align="right"| R057 || F6_rev_cap8 || gctacggtctcgccacagggttagtggttttgatttcttctcgctgg || 6 || reverse || 8
-|-
-|align="right"| R058 || F6_rev_cap9 || gctacggtctcgccaccgggttagtagttttaatttcttcttcgttggttatc || 6 || reverse || 9
-|-
-|align="right"| R059 || F7_for_cap1 || gctacggtctctgtggccaccgaaagatttgggaccgtggcagtcaatttc || 7 || forward || 1
-|-
-|align="right"| R060 || F7_for_cap2 || gctacggtctccgtggctacggagcagtatggttctgtatctaccaacctc || 7 || forward || 2
-|-
-|align="right"| R061 || F7_for_cap5 || gctacggtctccgtggcgtacaacgtcggcgggcagatg || 7 || forward || 5
-|-
-|align="right"| R062 || F7_for_cap6 || gctacggtctccgtggccaccgaaagatttgggactgtggcagtcaatctc || 7 || forward || 6
-|-
-|align="right"| R063 || F7_for_cap8 || gctacggtctctgtggctacagaggaatacggtatcgtggcagataacttg || 7 || forward || 8
-|-
-|align="right"| R064 || F7_for_cap9 || gctacggtctcggtagcaacggagtcctatggacaagtggccacaaaccac || 7 || forward || 9
-|-
-|align="right"| R065 || F7_rev_cap1 || gctacggtctcggtgatgaatgaagcaaactttgtagctgaaaac || 7 || reverse || 1
-|-
-|align="right"| R066 || F7_rev_cap2 || gctacggtctctgtgatgaaggaagcaaactttgccgcactgaag || 7 || reverse || 2
-|-
-|align="right"| R067 || F7_rev_cap5 || gctacggtctcggtgatgaagctgctgacgggcacgtccgagaag || 7 || reverse || 5
-|-
-|align="right"| R068 || F7_rev_cap6 || gctacggtctcggtgatgaatgaagcaaactttgtagccgaaaac || 7 || reverse || 6
-|-
-|align="right"| R069 || F7_rev_cap8 || gctacggtctccgtgatgaaagagttcagctttgactggttgaag || 7 || reverse || 8
-|-
-|align="right"| R070 || F7_rev_cap9 || gctacggtctcggtgatgaaagagttcagcttgtccttgttgaag || 7 || reverse || 9
-|-
-|align="right"| R071 || F8_for_cap1 || gctacggtctcatcacccaatactccacaggacaagtgagtgtgg || 8 || forward || 1
-|-
-|align="right"| R072 || F8_for_cap2 || gctacggtctcatcacacagtactccacgggacaggtcagcgtgg || 8 || forward || 2
-|-
-|align="right"| R073 || F8_for_cap5 || gctacggtctcatcacccagtacagcaccgggcaggtcaccgtgg || 8 || forward || 5
-|-
-|align="right"| R074 || F8_for_cap6 || gctacggtctcatcacccagtattccacaggacaagtgagcgtgg || 8 || forward || 6
-|-
-|align="right"| R075 || F8_for_cap8 || gctacggtctcatcacgcaatacagcaccggacaggtcagcgtgg || 8 || forward || 8
-|-
-|align="right"| R076 || F8_for_cap9 || gctacggtctcatcacccagtattctactggccaagtcagcgtgg || 8 || forward || 9
-|-
-|align="right"| R077 || F8_rev_cap1 || gctacggcgcgccttacaggggacgggtaaggtaacgggtgcc || 8 || reverse || 1
-|-
-|align="right"| R078 || F8_rev_cap2 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 2
-|-
-|align="right"| R079 || F8_rev_cap5 || gctacggcgcgccttaaaggggtcgggtaaggtatcgggttccgatagg || 8 || reverse || 5
-|-
-|align="right"| R080 || F8_rev_cap6 || gctacggcgcgccttacaggggacgggtgaggtaacgggtgcc || 8 || reverse || 6
-|-
-|align="right"| R081 || F8_rev_cap8 || gctacggcgcgccttacagattacgggtgaggtaacgggtgccaatggg || 8 || reverse || 8
-|-
-|align="right"| R082 || F8_rev_cap9 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 9
-|-
-|align="right"| R083 || Virbyte_for || gtctgagtgactagcattcggtctgagtgactagcattcg || - || forward
-|-
-|align="right"| R084 || Virobyte_rev || gctacggcgcgcctta || - || reverse
 |}
+</center>
+==miTuning Kit -  Intermediate Parts 2==
-==Primer Table Quick 'n' Dirty==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
+|+ align="top, left"|
-!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
+|width=40px|  ID||width=600px|Content||width=100px|Registry link||width=100px|Name
 |-
-|align="right"| L001 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || for use with L11 || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI
+|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1
 |-
-|align="right"| L002 || CMVshRNApA_KpnI_rv || taatggtacccagaagccatagagcccacc || - || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI
+|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2
 |-
-|align="right"| L003 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || for use with L8 || from PsiCheck2 || to pTR-UF3 BglII
+|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5
 |-
-|align="right"| L004 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || for use with L7 || from PsiCheck2 || to pTR-UF3 BglII
+|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6
 |-
-|align="right"| L005 || HSVluc_norm_KpnI_fw || tttttggtagcaggagcttcagggagtg || for use with L16 || from PsiCheck2 || to pTR-UF3 KpnI/SalI
+|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7
 |-
-|align="right"| L006 || HSVluc_norm_SalI_rv || ttttgtcgacggttccgcgcacatttccc || for use with L15 || from PsiCheck2 || to pTR-UF3 KpnI/SalI
+|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8
 |-
-|align="right"| L007 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || for use with L13 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI
-|-
-|align="right"| L008 || SV40luc_SalI_rv || tattgtcgacccgcgtcagacaaaccctaac || for use with L1 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI
-|-
-|align="right"| L009 || TetO2_StuI_NheI || ttttaggccttccctatcagtgatagagatctccctatcagtgatagagagctagctaac || Tet Repressor|| Oligo || to final tuning construct
-|-
-|align="right"| L010 || TetR_BspEI_fw || tttttccggaggcgaattgatatgtctagattag || for use with L14 || from pcDNA6/TR || pTR-UF3 BspEI/NotI
-|-
-|align="right"| L011 || TetR_SgfI_NotI_rv || ttttgcggccgctggcgatcgctaataagatctgaattcccgggatc || for use with L12 || from pcDNA6/TR || to pTR-UF3 BspEI/NotI
 |}
+</center>
+==ViroBytes==
+These parts are not submitted in the standardized form.
-==Primer Table raPCR ==
+<center>
+{| class="wikitable sortable" border="0" style="text-align: left"
+|-bgcolor=#cccccc
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
+|+ align="top, left"|
-!align="right"| ID !! Name !! Sequence (5' to 3') !! target !! Assembly Site !!
+|width=40px|  ID||width=150px|Part name||width=100px|Registry link||width=300px|Description
 |-
-|align="right"| ra001 || psicheck2_MCS_min_200_fw || cagcgacgatctgcctaa || sequencing fw || || sequencing Primer for binding-sites in pSiCheck vector
+|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra002 || psicheck2_MCS_plu_200_rv || gtggccaccaagaccaaa || sequencing rv || ||  sequencing Primer for binding-sites in pSiCheck vector
+|2 ||Fragment 2 of wt AAV1||[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra003 || raPCR_AS13-hsa-mir-122 || cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc || hsa-mir-122 || 13 bp ||
+|3 ||Fragment 3 of wt AAV1||[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra004 || raPCR_AS13-has-mir122(ran9-12) || cactgaatccaactgcaaacaccatnnnnacactccagcatacatggactgc || has-mir122 (ran9-12) || 13 bp || randomised nucleotides 9-12
+|4 ||Fragment 4 of wt AAV1||[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra005 || raPCR_AS13-hsa-mir-320b || cactgaatccaactgttgccctctcaacccagcttttgcatacatggactgc || hsa-mir-320b || 13 bp ||
+|5 ||Fragment 5 of wt AAV1||[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra006 || raPCR_AS13-has-mir-221 || cactgaatccaactggaaacccagcagacaatgtagctgcatacatggactgc || has-mir-221 || 13 bp ||
+|6 ||Fragment 6 of wt AAV1||[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra007 || raPCR_AS13-has-mir-221(ran9-12 || cactgaatccaactggaaacccagcannnnatgtagctgcatacatggactgc || has-mir-221 (ran9-12) || 13 bp || randomised nucleotides 9-12
+|7 ||Fragment 7 of wt AAV1||[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra008 || raPCR_AS13-has-mir-1179 || cactgaatccaactgccaaccaatgaaagaatgcttgcatacatggactgc || has-mir-1179 || 13 bp ||
+|8 ||Fragment 8 of wt AAV1||[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra009 || raPCR_AS13-has-mir-1179ran9-12 || cactgaatccaactgccaaccaatnnnngaatgcttgcatacatggactgc || has-mir-1179 (ran9-12) || 13 bp || randomised nucleotides 9-12
+|9 ||Fragment 1 of wt AAV2||[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra010 || raPCR_AS13-has-mir4286 || cactgaatccaactgggtaccaggagtggggtgcatacatggactgc || has-mir4286 || 13 bp ||
+|10 ||Fragment 2 of wt AAV2||[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra011 || raPCR_AS13-mm-mir-375 || cactgaatccaactgtcacgcgagccgaacgaacaaagcatacatggactgc || mm-mir-375 || 13 bp ||
+|11 ||Fragment 3 of wt AAV2||[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra012 || raPCR_AS13-mm-mir-375(ran9-12) || cactgaatccaactgtcacgcgagcnnnncgaacaaagcatacatggactgc || mm-mir-375 (ran9-12) || 13 bp || randomised nucleotides 9-12
+|12 ||Fragment 4 of wt AAV2||[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra013 || raPCR_AS13-mm-mir-376a || cactgaatccaactgacgtggattttcctctacgatgcatacatggactgc || mm-mir-376a || 13 bp ||
+|13 ||Fragment 5 of wt AAV2||[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra014 || raPCR_AS13-spacer(0) || cagttggattcagtggcagtccatgtatgc   || spacer || 13 bp ||
+|14 ||Fragment 6 of wt AAV2||[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra015 || raPCR_AS13-spacer(10) || cagttggattcagtggctatttctcgcagtccatgtatgc   || spacer || 13 bp ||
+|15 ||Fragment 7 of wt AAV2||[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra016 || raPCR_AS13-spacer(20) || cagttggattcagtgatgacaggtagctatttctcgcagtccatgtatgc   || spacer || 13 bp ||
+|16 ||Fragment 8 of wt AAV2||[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra017 || raPCR_AS13-stop_fw_BBB || ttttgaattcgcggccgcactagtcactgaatccaactg || stop fw || 13 bp ||
+|17 ||Fragment 1 of wt AAV5||[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra018 || raPCR_AS13-stop_rev_BBB || ttttctgcagcggccgcgctagcgcagtccatgtatgc || stop rev || 13 bp ||
+|18 ||Fragment 2 of wt AAV5||[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra019 || raPCR_AS13-stop_rev_NotI || ttttgcggccgctggagtgtgacaatggtgtttg || stop rev || 13 bp ||
+|19 ||Fragment 3 of wt AAV5||[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| ra020 || raPCR_AS13-stop_fw_XhoI || ttttctcgagcactgaatccaactg || stop fw || 13 bp ||
+|20 ||Fragment 4 of wt AAV5||[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]||flanked with Bsa1 sites at both ends
-|}
-==maus oligos==
-{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
-!align="right"| ID !! Name !! Sequence (5' to 3') !! Synthesis scale
 |-
-|align="right"| mouse1 || CMV_TetR_122bs_SalI_fw ||ttttgtcgaccgttgacattgattattgac || 25N
+|21 ||Fragment 5 of wt AAV5||[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]||flanked with Bsa1 sites at both ends
-|-
-|align="right"| mouae2 || CMV_TetR_both_MluI_rev || ttttacgcgttaacacacaaaaaaccaacac || 25N
 |-
-|align="right"| mouse3 || CMV_TetR_control_SalI_fw || ttttgtcgaccgttgacattgattattgac || 25N
+|22 ||Fragment 6 of wt AAV5||[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse4 || CMV_TetO2_EcoRI_fw || ttttgaattcgttgacattgattattgtctag || 25N
+|23 ||Fragment 7 of wt AAV5||[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse5 || Luc2_Ter_PstI_rev || ttttctgcagtaccacatttgtagaggttttac || 25N
+|24 ||Fragment 8 of wt AAV5||[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse6 || haat_bs_p_fw || tcgaggaagcgtttaggcatgtttaacatctctagagc || 25N
+|25 ||Fragment 1 of wt AAV6||[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse7 || haat_bs_p_rev || ggccgctctagagatgttaaacatgcctaaacgcttcc || 25N
+|26 ||Fragment 2 of wt AAV6||[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse8 || haat_bs_r10_12_aat_fw || tcgaggaagcgtaatggcatgtttaacatctctagagc || 25N
+|27 ||Fragment 3 of wt AAV6||[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse9 || haat_bs_r10_12_aat_rev || ggccgctctagagatgttaaacatgccattacgcttcc || 25N
+|28 ||Fragment 4 of wt AAV6||[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse10 || haat_bs_r10_12_agc_fw || tcgaggaagcgtagcggcatgtttaacatctctagagc || 25N
+|29 ||Fragment 5 of wt AAV6||[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse11 || haat_bs_r10_12_agc_rev || ggccgctctagagatgttaaacatgccgctacgcttcc || 25N
+|30 ||Fragment 6 of wt AAV6||[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse12 || haat_bs_m10at_fw || tcgaggaagcgttttggcatgtttaacatctctagagc || 25N
+|31 ||Fragment 7 of wt AAV6||[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse13 || haat_bs_m10at_rev || ggccgctctagagatgttaaacatgccaaaacgcttcc || 25N
+|32 ||Fragment 8 of wt AAV6||[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse14 || haat_bs_m10ac_fw || tcgaggaagcgtttcggcatgtttaacatctctagagc || 25N
+|33 ||Fragment 1 of wt AAV8||[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse15 || haat_bs_m10ac_rev || ggccgctctagagatgttaaacatgccgaaacgcttcc || 25N
+|34 ||Fragment 2 of wt AAV8||[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse16 || haat_bs_m11ta_fw || tcgaggaagcgttaaggcatgtttaacatctctagagc || 25N
+|35 ||Fragment 3 of wt AAV8||[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse17 || haat_bs_m11ta_rev || ggccgctctagagatgttaaacatgccttaacgcttcc || 25N
+|36 ||Fragment 4 of wt AAV8||[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse18 || haat_bs_m11tg_fw || tcgaggaagcgttgaggcatgtttaacatctctagagc || 25N
+|37 ||Fragment 5 of wt AAV8||[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse19 || haat_bs_m11tg_rev || ggccgctctagagatgttaaacatgcctcaacgcttcc || 25N
+|38 ||Fragment 6 of wt AAV8||[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse20 || haat_bs_r9_12_aatc_fw || tcgaggaagcgtaatcgcatgtttaacatctctagagc || 25N
+|39 ||Fragment 7 of wt AAV8||[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse21 || haat_bs_r9_12_aatc_rev || ggccgctctagagatgttaaacatgcgattacgcttcc || 25N
+|40 ||Fragment 8 of wt AAV8||[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse22 || haat_bs_r9_12_agcc_fw || tcgaggaagcgtagccgcatgtttaacatctctagagc || 25N
+|41 ||Fragment 1 of wt AAV9||[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse23 || haat_bs_r9_12_agcc_rev || ggccgctctagagatgttaaacatgcggctacgcttcc || 25N
+|42 ||Fragment 2 of wt AAV9||[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse24 || haat_bs_onlyseed_fw || tcgagcttcgcaaatcgcatgtttaacatctctagagc || 25N
+|43 ||Fragment 3 of wt AAV9||[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse25 || haat_bs_onlyseed_rev || ggccgctctagagatgttaaacatgcgatttgcgaagc || 25N
+|44 ||Fragment 4 of wt AAV9||[http://partsregistry.org/Part:BBa_K337101 BBa_K337101]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse26 || haat_bs_r16-18_fw || tcgaggttccgtttaggcatgtttaacatctctagagc || 25N
+|45 ||Fragment 5 of wt AAV9||[http://partsregistry.org/Part:BBa_K337102 BBa_K337102]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse27 || haat_bs_r16-18_rev || ggccgctctagagatgttaaacatgcctaaacggaacc || 25N
+|46 ||Fragment 6 of wt AAV9||[http://partsregistry.org/Part:BBa_K337103 BBa_K337103]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse28 || sAg_bs_p_fw || tcgagctcagtttactagtgccatttgttctctagagc || 25N
+|47 ||Fragment 7 of wt AAV9||[http://partsregistry.org/Part:BBa_K337104 BBa_K337104]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse29 || sAg_bs_p_rev || ggccgctctagagaacaaatggcactagtaaactgagc || 25N
+|48 ||Fragment 8 of wt AAV9||[http://partsregistry.org/Part:BBa_K337105 BBa_K337105]||flanked with Bsa1 sites at both ends
 |-
-|align="right"| mouse30 || sAg_bs_r10_12_acg_fw || tcgagctcagtttactagacgcatttgttctctagagc || 25N
-|-
-|align="right"| mouse31 || sAg_bs_r10_12_acg_rev || ggccgctctagagaacaaatgcgtctagtaaactgagc || 25N
-|-
-|align="right"| mouse32 || sAg_bs_r10_12_taa_fw || tcgagctcagtttactagtaacatttgttctctagagc || 25N
-|-
-|align="right"| mouse33 || sAg_bs_r10_12_taa_rev || ggccgctctagagaacaaatgttactagtaaactgagc || 25N
-|-
-|align="right"| mouse34 || sAg_bs_r9_12_acgg_fw || tcgagctcagtttactagacggatttgttctctagagc || 25N
-|-
-|align="right"| mouse35 || sAg_bs_r9_12_acgg_rev || ggccgctctagagaacaaatccgtctagtaaactgagc || 25N
-|-
-|align="right"| mouse36 || sAg_bs_r9_12_atgt_fw || tcgagctcagtttactagatgtatttgttctctagagc || 25N
-|-
-|align="right"| mouse37 || sAg_bs_r9_12_atgt_rev || ggccgctctagagaacaaatacatctagtaaactgagc || 25N
-|-
-|align="right"| mouse38 || sAg_bs_m10cg_fw || tcgagctcagtttactagtggcatttgttctctagagc || 25N
-|-
-|align="right"| mouse39 || sAg_bs_m10cg_rev || ggccgctctagagaacaaatgccactagtaaactgagc || 25N
-|-
-|align="right"| mouse40 || sAg_bs_m10ca_fw || tcgagctcagtttactagtgacatttgttctctagagc || 25N
-|-
-|align="right"| mouse41 || sAg_bs_m10ca_rev || ggccgctctagagaacaaatgtcactagtaaactgagc || 25N
-|-
-|align="right"| mouse42 || sAg_bs_m11gc_fw || tcgagctcagtttactagtcccatttgttctctagagc || 25N
-|-
-|align="right"| mouse43 || sAg_bs_m11gc_rev || ggccgctctagagaacaaatgggactagtaaactgagc || 25N
-|-
-|align="right"| mouse44 || sAg_bs_m11ga_fw || tcgagctcagtttactagtaccatttgttctctagagc || 25N
-|-
-|align="right"| mouse45 || sAg_bs_m11ga_rev || ggccgctctagagaacaaatggtactagtaaactgagc || 25N
-|-
-|align="right"| mouse46 || sAg_bs_onlyseed_fw || tcgagctcagtaatgatcacggatttgttctctagagc || 25N
-|-
-|align="right"| mouse47 || sAg_bs_onlyseed_rev || ggccgctctagagaacaaatccgtgatcattactgagc || 25N
-|-
-|align="right"| mouse48 || sAg_bs_r16-18_fw || tcgagctcagttatgtagtgccatttgttctctagagc || 25N
-|-
-|align="right"| mouse49 || sAg_bs_r16-18_rev || ggccgctctagagaacaaatggcactacataactgagc || 25N
-|-
-|align="right"| mouse50 || hAAT_cDNA_SalI_Bluescript_fw || ttttgtcgacgaccatgattacgccaagcg || 25N
-|-
-|align="right"| mouse51 || hAAT_cDNA_SalI_fw || ttttgtcgacgggtaccgggccccccgtcgaggatg || 25N
-|-
-|align="right"| mouse52 || hAAT_cDNA_XhoI_NotI_NheI_rev || ttttgctagcgcggccgcgtatctcgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse53 || hAAT_cDNA_sAg_bs_p_NheI_rev || ttttgctagcgaacaaatggcactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse54 || hAAT_cDNA_sAg_bs_r10_12_acg_NheI_rev || ttttgctagcgaacaaatgcgtctagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse55 || hAAT_cDNA_sAg_bs_r10_12_taa_NheI_rev || ttttgctagcgaacaaatgttactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse56 || hAAT_cDNA_bs_r9_12_acgg_NheI_rev || ttttgctagcgaacaaatccgtctagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse57 || hAAT_cDNA_sAg_bs_r9_12_atgt_NheI_rev || ttttgctagcgaacaaatacatctagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse58 || hAAT_cDNA_sAg_bs_m10cg_NheI_rev || ttttgctagcgaacaaatgccactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse59 || hAAT_cDNA_sAg_bs_m10ca_NheI_rev || ttttgctagcgaacaaatgtcactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse60 || hAAT_cDNA_sAg_bs_m11gc_NheI_rev || ttttgctagcgaacaaatgggactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse61 || hAAT_cDNA_sAg_bs_m11ga_NheI_rev || ttttgctagcgaacaaatggtactagtaaactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse62 || hAAT_cDNA_sAg_bs_onlyseed_NheI_rev || ttttgctagcgaacaaatccgtgatcattactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse63 || hAAT_cDNA_sAg_bs_r16-18_NheI_rev || ttttgctagcgaacaaatggcactacataactgaggctcaacccttctttaatg || 25N
-|-
-|align="right"| mouse64 || sAg_bs_p_fw_E || aattcctcagtttactagtgccatttgttcctgca ||  25N
-|-
-|align="right"| mouse65 || sAg_bs_p_rev_P || ggaacaaatggcactagtaaactgagg ||  25N
-|-
-|align="right"| mouse66 || sAg_bs_r10_12_acg_fw_E || aattcctcagtttactagacgcatttgttcctgca ||  25N
-|-
-|align="right"| mouse67 || sAg_bs_r10_12_acg_rev_P || ggaacaaatgcgtctagtaaactgagg ||  25N
-|-
-|align="right"| mouse68 || sAg_bs_r10_12_taa_fw_E || aattcctcagtttactagtaacatttgttcctgca ||  25N
-|-
-|align="right"| mouse69 || sAg_bs_r10_12_taa_rev_P || ggaacaaatgttactagtaaactgagg ||  25N
-|-
-|align="right"| mouse70 || sAg_bs_r9_12_acgg_fw_E || aattcctcagtttactagacggatttgttcctgca ||  25N
-|-
-|align="right"| mouse71 || sAg_bs_r9_12_acgg_rev_P || ggaacaaatccgtctagtaaactgagg ||  25N
-|-
-|align="right"| mouse72 || sAg_bs_r9_12_atgt_fw_E || aattcctcagtttactagatgtatttgttcctgca ||  25N
-|-
-|align="right"| mouse73 || sAg_bs_r9_12_atgt_rev_P || ggaacaaatacatctagtaaactgagg ||  25N
-|-
-|align="right"| mouse74 || sAg_bs_m10cg_fw_E || aattcctcagtttactagtggcatttgttcctgca ||  25N
-|-
-|align="right"| mouse75 || sAg_bs_m10cg_rev_P || ggaacaaatgccactagtaaactgagg ||  25N
-|-
-|align="right"| mouse76 || sAg_bs_m10ca_fw_E || aattcctcagtttactagtgacatttgttcctgca ||  25N
-|-
-|align="right"| mouse77 || sAg_bs_m10ca_rev_P || ggaacaaatgtcactagtaaactgagg ||  25N
-|-
-|align="right"| mouse78 || sAg_bs_m11gc_fw_E || aattcctcagtttactagtcccatttgttcctgca ||  25N
-|-
-|align="right"| mouse79 || sAg_bs_m11gc_rev_P || ggaacaaatgggactagtaaactgagg ||  25N
-|-
-|align="right"| mouse80 || sAg_bs_m11ga_fw_E || aattcctcagtttactagtaccatttgttcctgca ||  25N
-|-
-|align="right"| mouse81 || sAg_bs_m11ga_rev_P || ggaacaaatggtactagtaaactgagg ||  25N
-|-
-|align="right"| mouse82 || sAg_bs_onlyseed_fw_E || aattcctcagtaatgatcacggatttgttcctgca ||  25N
-|-
-|align="right"| mouse83 || sAg_bs_onlyseed_rev_P || ggaacaaatccgtgatcattactgagg ||  25N
-|-
-|align="right"| mouse84 || sAg_bs_r16-18_fw_E || aattcctcagttatgtagtgccatttgttcctgca ||  25N
-|-
-|align="right"| mouse85 || sAg_bs_r16-18_rev_P || ggaacaaatggcactacataactgagg ||  25N
 |}
+</center>
+<!-- <groupparts>iGEM010 Heidelberg</groupparts> -->
+<html>
+<div class="backtop">
+<a href="#top">&uarr;</a>
+</div>
+</html>
-{{:Team:Heidelberg/Pagemiddle}}
+{{:Team:Heidelberg/Single_Bottom}}
-{{:Team:Heidelberg/Bottom}}
-<html>
-</body>
-</html>

Team:Heidelberg/Parts

From 2010.igem.org