Team:SDU-Denmark/primers
From 2010.igem.org
(Difference between revisions)
m (→Primers) |
|||
(5 intermediate revisions not shown) | |||
Line 2: | Line 2: | ||
{{:Team:SDU-Denmark/navi2}} | {{:Team:SDU-Denmark/navi2}} | ||
<div id="subnavi"> | <div id="subnavi"> | ||
- | <div id=" | + | <div id="parts"> |
+ | |||
+ | = Our Parts = | ||
+ | <groupparts>iGEM010 SDU-Denmark</groupparts> | ||
+ | |||
+ | <br> | ||
== '''Primers''' == | == '''Primers''' == | ||
Line 9: | Line 14: | ||
<br> | <br> | ||
On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br> | On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br> | ||
+ | |||
+ | In the following, coding sequences are colored <span | ||
+ | style="color: rgb(88, 115, 248);">blue</span>, restriction sites are colored <span | ||
+ | style="color: rgb(80, 204, 56);">green</span> and nucleotides that are both are shown in <span | ||
+ | style="color: rgb(255, 153, 0);">orange</span>.<br> | ||
+ | The mutation sites in the FlhDC mutation primers are shown in <span | ||
+ | style="color: rgb(205, 51, 204);">purple</span>. | ||
+ | <br><br> | ||
<html> | <html> | ||
Line 19: | Line 32: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Primer |
name</td> | name</td> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 638px;">Sequence</td> |
<td | <td | ||
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">Tm | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">Tm | ||
Line 29: | Line 42: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC |
fw</td> | fw</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span |
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | ||
style="color: rgb(80, 204, 56);">TCTAG</span><span | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
Line 42: | Line 55: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC |
rv</td> | rv</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span |
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCTACTATT<span | style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCTACTATT<span | ||
style="color: rgb(88, 115, 248);">AAACAGCCTGTACTCTCTGTTC</span>-3'</td> | style="color: rgb(88, 115, 248);">AAACAGCCTGTACTCTCTGTTC</span>-3'</td> | ||
Line 53: | Line 66: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC |
mutation fw*</td> | mutation fw*</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span |
- | style="color: rgb(88, 115, 248);"> | + | style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCC<span |
+ | style="color: rgb(204, 51, 204);">C</span>GCAGCTTATG</span>-3'</td> | ||
<td | <td | ||
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | ||
Line 63: | Line 77: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC |
mutation rv*</td> | mutation rv*</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span |
- | style="color: rgb(88, 115, 248);"> | + | style="color: rgb(88, 115, 248);">CATAAGCTGC<span |
+ | style="color: rgb(204, 51, 204);">G</span>GGCAAAGCTGCCAA</span>-3'</td> | ||
<td | <td | ||
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | ||
Line 73: | Line 88: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor |
fw</td> | fw</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span |
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | ||
style="color: rgb(80, 204, 56);">TCTAG</span><span | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
Line 86: | Line 101: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor |
rv</td> | rv</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span |
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCT<span | style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCT<span | ||
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | ||
Line 98: | Line 113: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB |
fw</td> | fw</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span |
style="color: rgb(80, 204, 56);"><span | style="color: rgb(80, 204, 56);"><span | ||
style="color: black;">GTTTCTTC</span>GAATTC</span>GCGGCCGCT<span | style="color: black;">GTTTCTTC</span>GAATTC</span>GCGGCCGCT<span | ||
Line 112: | Line 127: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB |
rv</td> | rv</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span |
style="color: rgb(80, 204, 56);"><span | style="color: rgb(80, 204, 56);"><span | ||
style="color: black;">GTGTCTTC</span>CTGCAG</span>CGGCCGCT<span | style="color: black;">GTGTCTTC</span>CTGCAG</span>CGGCCGCT<span | ||
Line 125: | Line 140: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB |
2 fw**</td> | 2 fw**</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-CCGCT<span |
style="color: rgb(80, 204, 56);">TCTAG</span><span | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
style="color: rgb(88, 115, 248);"><span | style="color: rgb(88, 115, 248);"><span | ||
Line 137: | Line 152: | ||
<tr> | <tr> | ||
<td | <td | ||
- | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: | + | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB |
2 rv**</td> | 2 rv**</td> | ||
<td | <td | ||
- | style="font-family: Courier New; height: 44px; width: | + | style="font-family: Courier New; height: 44px; width: 638px;">5'-CGCT<span |
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | ||
style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td> | style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td> | ||
Line 157: | Line 172: | ||
</p> | </p> | ||
- | + | ||
- | + | ||
- | + | ||
</div> | </div> | ||
- | |||
- | |||
</div> | </div> |
Latest revision as of 21:47, 27 October 2010