Team:Heidelberg/Modeling/miBSdesigner
From 2010.igem.org
(Difference between revisions)
AlejandroHD (Talk | contribs) |
|||
(81 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
- | {{:Team:Heidelberg/ | + | {{:Team:Heidelberg/Double}} |
{{:Team:Heidelberg/Pagetop|mibsdesigner}} | {{:Team:Heidelberg/Pagetop|mibsdesigner}} | ||
<!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">--> | <!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">--> | ||
Line 7: | Line 7: | ||
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> | <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> | ||
<style type="text/css"> | <style type="text/css"> | ||
- | + | .wrapper {width: 260px; text-align:center;} | |
- | + | .wrapper2 {margin:auto; height: 700px; text-align:left; } | |
- | + | .title {padding-left:0px; line-height:2; font-weight:bold; font-size:17px;} | |
- | + | .option {padding-left:10px; white-space:pre-wrap;} | |
- | + | .optionl {padding-left:10px; white-space:pre-wrap; float:left; font-size:15px;} | |
- | + | .optionr {display:inline; white-space:pre-wrap; margin-right: 45px; float:right; font-size:15px;} | |
- | + | .suboption {padding-left:20px; font-size:15px;} | |
- | + | .clear {clear: both;} | |
- | + | .reswrap2 {padding:5px; width: 240px; margin:auto; text-align:left; display:none; font-size:12pt;} | |
+ | .variaresult {font-size: 16px; color: #11526f; font-weight: bold;} | ||
+ | .largetext {font-size: 17px;} | ||
+ | td {vertical-align:top;} | ||
</style> | </style> | ||
- | |||
</head> | </head> | ||
<body> | <body> | ||
<form name="seqIn" action=""> | <form name="seqIn" action=""> | ||
- | + | <div class="wrapper2"> | |
- | < | + | <center> |
- | + | <div class="t1"> | |
- | + | Construction of microRNA binding sites </div><br> | |
- | + | <div style="width:350px; text-align:right;"><span class="help"><a href="https://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Input" target="_blank" title="Input help">?</a><span></div> | |
- | + | <div class="largetext" style="width:450px;"> | |
- | + | Sequence name<br> | |
- | Sequence name | + | |
- | + | ||
<input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br> | <input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br> | ||
- | + | microRNA Sequence ( 5' -> 3')<br> | |
<input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br> | <input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br> | ||
- | + | Spacer (inert sequence)<br> | |
- | Spacer (inert sequence) | + | |
<input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/> | <input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/> | ||
+ | </center><br><br> | ||
+ | <div class="largetext" style="width:400px;"> | ||
+ | <input name="quality" value="perfect" onchange="chMd()" checked="checked" type="radio"> | ||
+ | Perfect Binding Site <br> | ||
+ | <input name="quality" value="bulge" onchange="chMd()" type="radio"> | ||
+ | Imperfect Binding Site with 4 nt bulge (9-12)<br> | ||
+ | <input name="quality" value="personal" onchange="chMd()" type="radio"> | ||
+ | Personalized Binding Site | ||
</div> | </div> | ||
<br> | <br> | ||
- | + | <table> | |
- | < | + | <tr height=120px> |
- | + | <td width=290px> | |
- | + | <div class="title"> | |
- | + | Seed sequence (1-8) <span class="help"><a href="https://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Seed_Types" target="_blank" title="Seed sequence help">?</a></span> | |
- | + | </div> | |
- | + | <div class="option"><SELECT name="seed" onchange="chMd1()" disabled="disabled"> | |
- | + | <OPTION value="0"> | |
- | + | <OPTION value="6mer">6mer (2-7 paired) | |
- | + | <OPTION value="7merA1">7merA1 (1-7 paired) | |
- | + | <OPTION value="7merm8">7merm8 (2-8 paired) | |
- | + | <OPTION value="8mer">8mer (1-8 paired) | |
- | + | <OPTION value="custom">Custom | |
- | + | </SELECT></div> | |
- | + | <div class="suboption"> | |
- | + | Customized <span style="color:#11526f; font-weight:bold;">MISMATCH</span> position | |
- | + | <input type="text" id="mis" size="29" disabled="disabled" value="2"/> | |
- | + | </div> | |
- | + | </td> | |
- | + | <td> | |
- | + | <div class="title"> | |
- | + | Supplementary region <span class="help"><a href="https://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Supplementary_Region" title="Supplementary region help" target="_blank">?</a></span></div> | |
- | + | <div class="option"><SELECT name="comp" onchange="chMd2()" disabled="disabled"> | |
- | + | <OPTION value="0"> | |
- | + | <OPTION value="3">3 (14-16 paired) | |
- | + | <OPTION value="4">4 (13-16 paired) | |
- | + | <OPTION value="5">5 (13-17 paired) | |
- | + | <OPTION value="6">6 (13-18 paired) | |
- | + | <OPTION value="7">7 (13-19 paired) | |
- | + | <OPTION value="8">8 (13-20 paired) | |
- | + | <OPTION value="total">Total (13-22 paired) | |
- | + | <OPTION value="custom">Custom | |
- | + | </SELECT></div> | |
- | + | <div class="suboption"> | |
- | + | Customized <span style="color: #11526f; font-weight:bold;">MATCH</span> positions | |
- | + | <input type="text" id="match" size="29" disabled="disabled" value="10, 15, 16, 17, 18, 19, 20"/> | |
- | + | </div> | |
- | + | </td> | |
- | + | </tr> | |
- | + | <tr> | |
- | + | <td> | |
- | + | <div class="title"> | |
- | + | Modify AU content <span class="help"><a href="https://2010.igem.org/Team:Heidelberg/Modeling/trainingset#AU_Content" target="_blank" title="AU help">?</a></span></div> | |
- | + | <table style="line-height:2; font-size:12px;"> | |
- | + | <tr> | |
- | + | <td width=130px> | |
- | + | <input name="AU" value="-1" type="checkbox">A in position -1<br> | |
- | + | <input name="AU" value="1" disabled="disabled" type="checkbox">A in position 1<br> | |
- | + | <input name="AU" value="9" disabled="disabled" type="checkbox">A in position 9<br> | |
- | + | </td> | |
- | < | + | <td> |
- | + | <input name="AU" value="0" type="checkbox">A in position 0<br> | |
- | + | <input name="AU" value="8" disabled="disabled" type="checkbox">A in position 8<br> | |
- | + | <input name="AU" value="10" disabled="disabled" type="checkbox">A in position 10<br> | |
- | + | </td> | |
- | + | </tr> | |
- | + | </table> | |
- | + | </td> | |
- | + | <td> | |
- | + | <div class="title">Sticky ends for integration into plasmid <span class="help"><a href="https://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Sticky_Ends target="_blank" title="ends help"">?</a></span></div></div> | |
- | + | <div class="option"><SELECT id="stickyends" name="stickyends" onchange="chMd3()"> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | <div class=" | + | |
- | <div class="option"> | + | |
<OPTION SELECTED value="none">None | <OPTION SELECTED value="none">None | ||
<OPTION value="BBB">Biobricks Standard RFC-12 | <OPTION value="BBB">Biobricks Standard RFC-12 | ||
Line 111: | Line 111: | ||
<OPTION value="custom">Custom sequence | <OPTION value="custom">Custom sequence | ||
</SELECT></div> | </SELECT></div> | ||
- | <div class=" | + | <div class="suboption">Customized:<br> |
+ | 5' <input type="text" id="end5" size="15" disabled="disabled"/><br> | ||
+ | 3' <input type="text" id="end3" size="15" disabled="disabled"/> | ||
</div> | </div> | ||
+ | </td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | <br> | ||
<center> | <center> | ||
- | <input value=" | + | <input value=" Generate your Binding Site! " type="button" onclick="SBS(seqIn)"> |
- | </center> | + | </center> |
- | + | </div> | |
- | + | ||
</form> | </form> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</body> | </body> | ||
+ | <script type="text/javascript" src="https://static.igem.org/mediawiki/2010/3/3a/Very_final_code_miBS_HD2010.txt"> </script> | ||
</html> | </html> | ||
{{:Team:Heidelberg/Pagemiddle}} | {{:Team:Heidelberg/Pagemiddle}} | ||
+ | <html> | ||
+ | <div class="wrapper"> | ||
+ | <img style="border-width: 0px;" src="https://static.igem.org/mediawiki/2010/c/c0/MiBSdesigner.png" width="260" height="147" /> | ||
+ | <br><br> | ||
+ | <div class="reswrap2" id="resultdiv"> | ||
+ | <div class="variaresult">Name of primer 1</div> | ||
+ | <textarea name="NamA" cols=25 rows=1 id="NamA" wrap=SOFT></textarea><br><br> | ||
+ | <div class="variaresult">Sequence of primer 1</div> | ||
+ | <textarea name="seqA" cols=25 rows=3 id="seqA" wrap=SOFT></textarea><br><br> | ||
+ | <div class="variaresult">Name of primer 2</div> | ||
+ | <textarea name="NamB" cols=25 rows=1 id="NamB" wrap=SOFT></textarea><br><br> | ||
+ | <div class="variaresult">Sequence of primer 2</div> | ||
+ | <textarea name="seqB" cols=25 rows=3 id="seqB" wrap=SOFT></textarea><br> | ||
+ | </div></div> | ||
+ | </html> | ||
{{:Team:Heidelberg/Bottom}} | {{:Team:Heidelberg/Bottom}} |
Latest revision as of 13:40, 27 October 2010
|
|
||