Team:Warsaw/Stage1/PromMeas
From 2010.igem.org
Line 30: | Line 30: | ||
pT7 41,8pg RNA/minute/ug substrate DNA | pT7 41,8pg RNA/minute/ug substrate DNA | ||
<br> J23100 13,1pg RNA/minute/ug substrate DNA<br><br> | <br> J23100 13,1pg RNA/minute/ug substrate DNA<br><br> | ||
- | <p>It means that for pT7 we put into cell-free system <b>from 1 ug of DNA polymerase made around 41 pg RBS in a one minute, is it a good unit for promoter activity?</b> What happenswhen we input into our cell-free system DNA with the same biobrick, but in a different vector? The amount of DNA changes, but it doesn't change the number of available RBS. Therefore we have to change those units to something | + | <p>It means that for pT7 we put into cell-free system <b>from 1 ug of DNA polymerase made around 41 pg RBS in a one minute, is it a good unit for promoter activity?</b> What happenswhen we input into our cell-free system DNA with the same biobrick, but in a different vector? The amount of DNA changes, but it doesn't change the number of available RBS. Therefore we have to change those units to something resonable - like <b>numbers of RNA molecules made from 1 DNA molecule in a unit of time</b>. Sounds like <a href="http://partsregistry.org/wiki/index.php/Part_Types:Measurement_Systems">PoPs (polymerase per second) per DNA copy</a></p> |
<br>How did we come up with those values...<br> | <br>How did we come up with those values...<br> |
Revision as of 13:39, 26 October 2010
Promoter measurement
Experimental setup
We have measured J23100 and I719005 encoding pT7.
J23100 with our reference RBS has RNA synthesis rate of 13,1pg RNA/minute/ug substrate DNApT7 with our reference RBS has RNA synthesis rate of 41,8pg RNA/minute/ug substrate DNA
We have used B0034 as our reference RBS and E0040 GFP as a reporter:
<partinfo>BBa_K299009 DeepComponents</partinfo>
<partinfo>BBa_K299024 DeepComponents</partinfo>
Measured promoter strengths are as follows:
pT7 41,8pg RNA/minute/ug substrate DNAJ23100 13,1pg RNA/minute/ug substrate DNA
It means that for pT7 we put into cell-free system from 1 ug of DNA polymerase made around 41 pg RBS in a one minute, is it a good unit for promoter activity? What happenswhen we input into our cell-free system DNA with the same biobrick, but in a different vector? The amount of DNA changes, but it doesn't change the number of available RBS. Therefore we have to change those units to something resonable - like numbers of RNA molecules made from 1 DNA molecule in a unit of time. Sounds like PoPs (polymerase per second) per DNA copy
How did we come up with those values...
We expressed known amount if DNA in a cell-free expression system and measured RNA content over time using RTq-PCR. Simply we put the DNA into the tube with the cell-free expression system and collected samples of the mixture every 15 minutes. Then we did the reverse transcription to be able to perform a q-PCR that gives information on the amount of starting material.
Figure 1 shows you the dynamic performance of J23100 and T7 promoters - the amount of RNA versus time. Figure 2 show amplification curves that we got after RTq-PCR.
Fig 1. Dynamic performance of J23100 and pT7.
![](https://static.igem.org/mediawiki/2010/1/1c/Amplification_curve_T7.png)
![](https://static.igem.org/mediawiki/2010/c/c5/Amplification_curve_J23.png)
All measurements were conducted in cell-free system which allowed us simple and precise determination of GFP encoding mRNA. The amount of mRNA was determined using quantitative reverse transcriptase realtime PCR (qRT-PCR). We have done absolute quantification using cDNA standard curve to convert delta-Ct units to RNA concentration.
We have used following protocol:
- All reagents and substrates were RNase free. Experiments were conducted in RNase-free environment.
- 0.5 ug of DNA encoding tested construct was added to 50 ul of cell-free expression master mix containing 350 units of human placental RNase inhibitor.
- Samples were incubated at 37oC with shaking at 800 RPM
- Every 15 minutes 5ul of reaction mixture was collected. Reaction was stopped by freezing at -20. Samples were kept frozen until reverse transcription.
- Subsamples were being collected untill reaction have reached steady state (typically 120 minutes).
- After obtaining all RNA samples DNAse treatment was performed as follows: 5 ul of sample was supplemented with 1ul of 10x DNAse buffer, 3 ul of RNase-free water and 1ul of RNase-free DNase I from Fermentas
- Samples were incubated at 37oC for 30 minutes. After that time 1ul of EDTA was added to each sample.
- DNase was inactivated by heating in 65oC for 10 minutes.
- DNase treated RNA samples were divided in two. One half was used as a substrate for reverse transcription. The other halves were mixed together and used in -RT control reaction.
- Reverse transcription was performed using Maxima First Strand cDNA synthesis kit form Fermentas using manufacturer's instructions. Gene specific primer GFPqPCRr (TCGAAAGGGCAGATTGTG) was used.
- cDNA was diluted 50x and 1ul was used for qRT-PCR reaction. SYBR/ROX qPCR HotStart 2x Master Mix for Fermentas was used to perform the reaction with the following primers: GFPqPCRf (GATGACGGGAACTACAAGAC) and GFPqPCRr (TCGAAAGGGCAGATTGTG). ABI 7500 qPCR system was used. PCR program: 95oC for 10 minutes followed with 40 cycles of 95oC for 15s, 55oC for 30 s, 72oC for 40s. Reaction specificity was confirmed using melting curve analysis.