"
Team:Imperial College London/Software Tool
From 2010.igem.org
| Line 21: | Line 21: | ||
det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | ||
det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity."; | det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity."; | ||
| + | det[8] = "Caspases are used extensively in ''in vitro'' studies. They play a crucial role in apoptosis, including degrading genomic DNA and breaking down the cytoskeleton. Caspase 3 is an '''effector''' caspase and also plays a key role in the development of various human tissues."; | ||
| + | det[9] = "Caspases are used extensively in ''in vitro'' studies. They play a crucial role in apoptosis, including degrading genomic DNA and breaking down the cytoskeleton. Caspase 5 is an '''inflammatory''' caspase and is involved in cytokine maturation."; | ||
| + | det[10] = "Caspases are used extensively in ''in vitro'' studies. They play a crucial role in apoptosis, including degrading genomic DNA and breaking down the cytoskeleton. Caspase 9 is an '''initiator''' caspase and cleaves inactive pro-forms of effector caspases, thereby activating them"; | ||
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | ||
| Line 35: | Line 38: | ||
cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | ||
cleavage[7] = "GAAAACTTATACTTCCAAGGA"; | cleavage[7] = "GAAAACTTATACTTCCAAGGA"; | ||
| + | cleavage[8] = "GACATGCAAGACGGA"; | ||
| + | cleavage[9] = "TTAGAACATGACGGA"; | ||
| + | cleavage[10] = "TTAGAACATGACGGA"; | ||
var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | ||
var terminator = "TAATAA"; | var terminator = "TAATAA"; | ||
| Line 83: | Line 89: | ||
<option value="6">Leishmanolysin</option> | <option value="6">Leishmanolysin</option> | ||
<option value="7">TEV</option> | <option value="7">TEV</option> | ||
| + | <option value="8">Caspase 3</option> | ||
| + | <option value="9">Caspase 5</option> | ||
| + | <option value="10">Caspase 9</option> | ||
</select> | </select> | ||
</html> | </html> | ||
Revision as of 13:24, 24 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Violet - Scar Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
| What else could we attach to a cell wall binding domain? |
|
Attaching enzymes to the surface of B. subtilis: This could be done for a variety of applications. One example are the lignocellulose breakdown enzymes like cellulase, hemicellulase, and ligninase. Because lignocellulos material can't enter bacteria cells, it has to be broken down into monosaccharides first, which can then be absorbed and subsequently used for biofuel production.
PAMPs are sensed by our innate immune system, specifically by pattern-recognition receptors (PRRs). PAMPs are often shared between many different classes of microbes, so they work well as a generic target for the immune system early on in an infection. Flagellin is one such PAMP and is recognised by the PRR called Toll-like receptor 5 (TLR-5). Flagellin monomers make up flagella of many bacteria, giving them motility which often confers pathogenicity. Engineering a flagellin monomer to be bound to the exterior of our organism could initiate an immune response, such as production of TNF which could help inhivbit viral replication in the body.
Antigen presentation is vital when initiating the adaptive immune response. There are many different proteins that we could engineer to be on the surface of our organism, which would be phagocytosed by antigen presenting cells (APCs). These APCs would then display the antigen on their surface, held in place by a majorhistocompatability complex (MHC) Class II molecule. |
