Team:Kyoto/Parts
From 2010.igem.org
(→K358000) |
(→K358000) |
||
Line 9: | Line 9: | ||
The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5. | The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5. | ||
- | |||
- | |||
====<partinfo>K358001</partinfo>==== | ====<partinfo>K358001</partinfo>==== |
Revision as of 12:10, 23 October 2010
Parts
Original
List
<groupparts>iGEM010 Kyoto</groupparts>
<partinfo>K358000</partinfo>
<partinfo>BBa_K358000 Short</partinfo>
The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5.
<partinfo>K358001</partinfo>
<partinfo>BBa_K358001 short</partinfo>
constitutive promoter[J23101] with GFP on low plasmid[pSB4K5]
<partinfo>K358004</partinfo>
<partinfo>BBa_K358004 short</partinfo>
This part causes cell death. It contains holin/antiholin, endolysin and Rz/Rz1 genes.
<partinfo>K358006</partinfo>
<partinfo>BBa_K358006 short</partinfo>
λ lysis cassette <partinfo>BBa_K358004</partinfo> with double terminator <partinfo>BBa_B0015</partinfo>.
<partinfo>K358010</partinfo>
<partinfo>BBa_K358010 short</partinfo>
It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette[BBa_K358005]: the killer gene.
<partinfo>K358012</partinfo>
<partinfo>K358013</partinfo>
<partinfo>K358015</partinfo>
<partinfo>K358016</partinfo>
<partinfo>K358017</partinfo>
<partinfo>K358018</partinfo>
<partinfo>K358019</partinfo>
<partinfo>K358020</partinfo>
<partinfo>K358021</partinfo>
BioBrick
Parts
Name | Description | Well*1 | Plasmid | Resistance | Insert Length | Vector Length |
---|---|---|---|---|---|---|
<partinfo>J23100</partinfo> | Constitutive promoter family member | 1-18-C | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
<partinfo>J23105</partinfo> | Constitutive promoter family member | 1-18-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
<partinfo>J23116</partinfo> | Constitutive promoter family member | 1-20-M | <partinfo>J61002</partinfo> | Ampicillin | 35 | 2948 |
<partinfo>R0011</partinfo> | Promoter (lacI regulated, lambda pL hybrid) | 1-6-G | <partinfo>pSB1A2</partinfo> | Ampicillin | 55 | 2079 |
<partinfo>B0015</partinfo> | Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>) | 1-23-L | <partinfo>pSB1AK3</partinfo> | Ampicillin, Kanamycin | 129 | 3189 |
<partinfo>E0840</partinfo> | GFP generator | 1-12-O | <partinfo>pSB1A2</partinfo> | Ampicillin | 878 | 2079 |
<partinfo>E0240</partinfo> | GFP generator | 1-12-M | <partinfo>pSB1A2</partinfo> | Ampicillin | 876 | 2079 |
<partinfo>I20260</partinfo> | Measurement Kit Test of <partinfo>J23101</partinfo> | 2-17-F | <partinfo>pSB3K3</partinfo> | Kanamycin | 919 | 2750 |
<partinfo>J06702</partinfo> | mCherry, bacterial with RBS and forward terminator | 2-8-E | <partinfo>pSB1A2</partinfo> | Ampicillin | 869 | 2079 |
<partinfo>pSB3K3</partinfo> | RFP Coding Device | 1-5-E | <partinfo>pSB3K3</partinfo> | Kanamycin | 1069 | 2750 |
<partinfo>pSB4K5</partinfo> | Low copy BioBrick standard vector | 1-5-G | <partinfo>pSB4K5</partinfo> | Kanamycin | 1069 | 3419 |
<partinfo>pSB1C3</partinfo> | High copy BioBrick assembly plasmid | <partinfo>pSB1C3</partinfo> | Chloramphenicol | 2072 |
- *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1.
Primers
Name | Description | Sequence |
---|---|---|
<partinfo>G00100</partinfo> | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa |
<partinfo>G00101</partinfo> | Reverse primer for sequencing/amplifying BioBrick parts (VR) | attaccgcctttgagtgagc |