Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
Line 20: | Line 20: | ||
det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | ||
det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | det[6] = "This protease is produced by the ''leishmania'' parasites which cause leishmaniasis, an NTD. Diagnosis currently takes at least 20 minutes and requires microscopy. Our kit would allow rapid detection with very simple apparatus. "; | ||
+ | det[7] = "This cysteine protease is made by the Tobacco Etch Virus (TEV). It is often used as a molecular biology tool as it is very well characterised and has a high degree of activity and specificity."; | ||
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGT"; | ||
Line 33: | Line 34: | ||
cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC"; | cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC"; | ||
cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | cleavage[6] = "CTGATTGCGTATCTGAAAAAAGCGACC"; | ||
+ | cleavage[7] = "GAAAACTTATACTTCCAAGGA"; | ||
var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | ||
var terminator = "TAATAA"; | var terminator = "TAATAA"; | ||
Line 80: | Line 82: | ||
<option value="5">C3 Convertase</option> | <option value="5">C3 Convertase</option> | ||
<option value="6">Leishmanolysin</option> | <option value="6">Leishmanolysin</option> | ||
+ | <option value="7">TEV</option> | ||
</select> | </select> | ||
</html> | </html> |
Revision as of 17:20, 20 October 2010
Software Tool |
We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
Select Protease | Description | |
This was our primary target. Read our wiki to find out more! | ||
Awaiting sequence generation...
| ||
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Violet - Scar Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator |