"
Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
| Line 21: | Line 21: | ||
det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection."; | ||
var prefix = "GAATTCGCGGCCGCTTCTAG"; | var prefix = "GAATTCGCGGCCGCTTCTAG"; | ||
| - | var promoter = " | + | var promoter = "AATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGAC AAAAATGGGCTCGTGTTGTACAATAAATGT"; |
var rbs = "TACTAGAGTCTTCAGAAAGGAGT"; | var rbs = "TACTAGAGTCTTCAGAAAGGAGT"; | ||
var scar = "blank"; | var scar = "blank"; | ||
| Line 105: | Line 105: | ||
'''<span style="color:#D34649">Red</span> - Ribosome Binding Site''' | '''<span style="color:#D34649">Red</span> - Ribosome Binding Site''' | ||
| + | |||
| + | '''<span style="color:#FFFFFF">White</span> - Scar''' | ||
'''<span style="color:#AB6197">Purple</span> - Cell Wall Binding Domain''' | '''<span style="color:#AB6197">Purple</span> - Cell Wall Binding Domain''' | ||
Revision as of 11:39, 20 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site White - Scar Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
