"
Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
| Line 20: | Line 20: | ||
det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; | ||
det[5] = "test5"; | det[5] = "test5"; | ||
| - | var prefix = " | + | var prefix = "GAATTCGCGGCCGCTTCTAG"; |
var promoter = "blank"; | var promoter = "blank"; | ||
var rbs = "TACTAGAGTCTTCAGAAAGGAGT"; | var rbs = "TACTAGAGTCTTCAGAAAGGAGT"; | ||
| Line 30: | Line 30: | ||
cleavage[3] = "AAAAAAGTTAAAGCTAAAAAA"; | cleavage[3] = "AAAAAAGTTAAAGCTAAAAAA"; | ||
cleavage[4] = "ATCGACGGACGT"; | cleavage[4] = "ATCGACGGACGT"; | ||
| - | cleavage[5] = " | + | cleavage[5] = "TTATTATCTCGTTCTGAAGAAGAC"; |
var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTT CAAAGGAAAAAA"; | var aip = "GAAATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTT CAAAGGAAAAAA"; | ||
var terminator = "TAATAA"; | var terminator = "TAATAA"; | ||
| - | var suffix = " | + | var suffix = "TACTAGTAGCGGCCGCTGCAG"; |
$("#paraselect").change(function() | $("#paraselect").change(function() | ||
| Line 75: | Line 75: | ||
<option value="3">Cruzipain</option> | <option value="3">Cruzipain</option> | ||
<option value="4">Factor Xa</option> | <option value="4">Factor Xa</option> | ||
| - | <option value="5"> | + | <option value="5">C3 Convertase</option> |
</select> | </select> | ||
</html> | </html> | ||
Revision as of 11:17, 20 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
