Template:ESBS-Strasbourg/biobricks

From 2010.igem.org

<a name="PIF3"></a> Phytochrome Interacting Factor-3 (PIF3) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000">BBa_K365000</a>

Background:

PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.

Conception:

The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a>
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.

PIF3

The plasmid containing the PIF3-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#kircher">the laboratory of Stephan Kircher</a> from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 51 bp
GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC</p>

Reverse primer (5’->3’): 51 bp
ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC</p>

In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’) (24 bp)
GCAAACTCTTCAAGAGCTAGAGAG

Reverse primer (5’->3’) (24 bp)
CTCTCTAGCTCTTGAAGAGTTTGC

</td> </tr>

<a name="PIF6"></a> Phytochrome Interacting Factor-6 (PIF6) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001">BBa_K365001</a>

Background:

For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a> screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to coexpressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane.

Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF
pairs in a fluorescence translocation assay.

Conception: We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a>.

PIF6

The plasmid containing the PIF6-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a> from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 54 bp
GGATCCgaattcgcggccgcttctagatggccggcATGATGTTCTTACCAACCG

Reverse primer (5’->3’): 58 bp
CAGCTGctgcagcggccgctactagtattaaccggtGTCAACATGTTTATTGCTTTCC
</div> </td> </tr>

<a name="PHY908"></a> Phytochrome B (aa 1-908) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002">BBa_K365002</a>

Background:

Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm).

The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.

Conception:

In in-vivo applications it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light. <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt (2009)</a> demonstrated by assaying PIF6 (which has the strongest interactions of all previously reported PIF domains) against different variants of PhyB that the tandem C-terminal PAS domains (residues 1-908)of plant phytochromes are necessary to confer rapid photoreversibility under infrared light <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a>. The original sequence contains a SpeI restriction within the first 908 residues.

PIF6

The plasmid containing the PhyB-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.

Forward primer (5’->3’): (41bp)
GGATCCgaattcgcggccgcttctagATGGTTTCCGGAGTC

Reverse primer (5’->3’): (52 bp)
CAGCTGctgcagcggccgctactagtattaaccggtGCTCGGGATTTGCAAG

In order to get a sequence without an internal restriction sites of one of the BioBrick standards theSpeI-restriction site was altered without changing the encoded amino acid (ACT=Threonine (AC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’): (28 bp)
GGACAAGACGTTACGAGTCAGAAAATCG

Reverse primer (5’->3’): (27 bp)
CGATTTTCTGACTCGTAACGTCTTGTC

</td> </tr>

<a name="PHY642"></a> Phytochrome B (aa 1-642) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003">BBa_K365003</a>

Background:

Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm).

The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.

Conception:

</td> </tr>

...

</td> </tr>

<a name="Linker"></a> Linker (aa 20) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005">BBa_K365005</a>

...

</td> </tr>

...

</td> </tr>

...

</td> </tr>

<a name="Lambda"></a> Lambda tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008">BBa_K365008</a>

...

</td> </tr>

<a name="GFP"></a> GFP (super fold) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009">BBa_K365009</a>

...

</td> </tr>

<a name="PHYB642-CLPX3"></a> PhyB642-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010">BBa_K365010</a>

...

</td> </tr>

<a name="PHYB908-CLPX3"></a> PhyB908-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011">BBa_K365011</a>

...

</td> </tr>

<a name="CLPX"></a> Full-length ClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012">BBa_K365012</a>

...

</td> </tr>

<a name="NCLPX-L"></a> ∆NClpX-linker-∆NClpX-linker-∆NClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013">BBa_K365013</a>

...

</td> </tr>

<a name="L-NCLPX"></a> (linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014">BBa_K365014</a>

...

</td> </tr>

16

...

</td> </tr>