Team:NYMU-Taipei/Experiments

From 2010.igem.org

(Difference between revisions)
(Parts)
 
(10 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:NYMU-Taipei/Header}}
{{:Team:NYMU-Taipei/Header}}
 +
 +
[[Image:NYMU DSC05679.JPG|320px]]
 +
<div style="float:right;padding:10px;">__TOC__</div>
= <font color=blue>Experiments</font> =
= <font color=blue>Experiments</font> =
-
Lab notebooks:
+
Lab notebooks (click the following links to see details):
* [[Team:NYMU-Taipei/Experiments/Riboswitch|Speedy switch lab notebook]]
* [[Team:NYMU-Taipei/Experiments/Riboswitch|Speedy switch lab notebook]]
* [[mRNA Binding Experiments|Speedy reporter lab notebook]]
* [[mRNA Binding Experiments|Speedy reporter lab notebook]]
-
** [[speedy reporter protocol]]
 
* [[SsrA Experiment|Speedy protein degrader lab notebook]]
* [[SsrA Experiment|Speedy protein degrader lab notebook]]
Line 11: Line 13:
* [[Team:NYMU-Taipei/Experiments/Speedy switch#Results|Speedy switch results]]: Several reporter gene assay results for testing the Theophylline riboswitch.
* [[Team:NYMU-Taipei/Experiments/Speedy switch#Results|Speedy switch results]]: Several reporter gene assay results for testing the Theophylline riboswitch.
* [[Team:NYMU-Taipei/Experiments/Speedy degrader#Results|Speedy degrader results]]: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.
* [[Team:NYMU-Taipei/Experiments/Speedy degrader#Results|Speedy degrader results]]: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.
-
*
 
== Protocols, preparation and other stuff ==
== Protocols, preparation and other stuff ==
Line 29: Line 30:
<groupparts>iGEM010 NYMU-Taipei</groupparts>
<groupparts>iGEM010 NYMU-Taipei</groupparts>
-
= Primers =
+
= <font color=blue>Primers</font> =
-
A list of all the primers we ordered.
+
This is a list of all the primers we designed for
== Speedy Reporter ==
== Speedy Reporter ==

Latest revision as of 03:09, 28 October 2010


NYMU DSC05679.JPG

Contents

Experiments

Lab notebooks (click the following links to see details):

Experimental results:

  • Speedy switch results: Several reporter gene assay results for testing the Theophylline riboswitch.
  • Speedy degrader results: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.

Protocols, preparation and other stuff

Parts

The range given to each group for this years' parts was divided as follows:

  • Speedy Switch: K411000-K411099
  • Speedy Reporter: K411100-K411199
  • Speedy Protein degrader: K411200-K411299

The designed parts: <groupparts>iGEM010 NYMU-Taipei</groupparts>

Primers

This is a list of all the primers we designed for

Speedy Reporter

name sequence length desc
eIF4A_split_A_Fp cggcagcagcggcagcggcagcATGGAGCCGGAAGGCGTCATCGA 45
eIF4A_split_B_Rp ctgcagcggccgctactagtaTCAAATGAGGTCAGCAACGTTGAG 45
GFP_split_A_FP gaattcgcggccgcttctagagatgcgtaaaggagaagaacttttc 46
GFP_split_B_RP ctgccgctgctgccgctgctgccttattatttgtatagttcatccatgcca 51
GFP_split_A_RP gctgccgctgctgccgctgctgccttgtttgtctgccatgatgtatac 48
GFP_split_B_FP gctgccgctgctgccgctgctgcctttgtatagttcatccatgccatg 48
aptamer_FP gcttctagagacactcggaggacagcttagatgcaaagccggagtgagtgtacacc 56
aptamer_RP agcctgcagcggccgctactagtattcccctggcgcggggtgtacactcactccggct 58
eIFA_FP gcttctagATGGAGCCGGAAGGCGTCATCGA 31
eIF4A_mut1_FP ccatatcaattctccagcagattga 25
eIF4A_mut1_RP caatctgctggagaattgatatggc 25
eIF4A_mut2_FP gcagaagctccagatggaa 19
eIF4A_mut2_RP tccatctggagcttctgca 19
eIF4A_split_A_Rp ctgcagcggccgctactagtatcaagggtctctcataaatttcttgg 47
eIF4A_split_B_Fp cggcagcagcggcagcggcagcattcggattcttgtcaagaagg 44
RFP_split_A_FP gaattcgcggccgcttctagatggcttcctccgaagac 38
RFP_split_A_RP gctgccgctgctgccgctgctgccgtcttccgggtacatacgtt 44
RFP_split_B_FP gaattcgcggccgcttctagatgggtgctctgaaaggtgaaatc 44
RFP_split_B_RP gctgccgctgctgccgctgctgccagcaccggtggagtga 40
Total 773

Speedy Switch

name sequence length
Theophylline Riboswitch FP gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag56
Theophylline Riboswitch RP ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac62

Speedy Protein Degrader

name sequence length desc
GFPLVA_out_FP gcttctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc 52
RFPLVA_out_FP gcttctagagaaagaggagaaatactagatggct 34
RFPLVA_in_RP CTACTAAAGCGTAGTTTTCGTCGTTTGCAGCagcaccggtggagtga 47
SspB_FP gcttctagatgGATTTGTCACAGCTAACAC 30
SspB_RP ctgcagcggccgctactagtattaCTTCACAACGCGTAATGC 41
RFP_FP gcttctagatggcttcctccgaagac 26
GFP_FP gcttctagatgcgtaaaggagaagaacttttc 32
xFP_LVA_Remover_FP gagctgtacaagaggccttaataatactagagccaggcatca 42
xFP_LVA_Remover_RP tgatgcctggctctagtattattaaggcctcttgtacagctc 42
Total 346