"
Team:Imperial College London/Software Tool
From 2010.igem.org
(Difference between revisions)
| Line 16: | Line 16: | ||
var det = new Array(); | var det = new Array(); | ||
det[1] = "This was our primary target. Read our wiki to find out more!"; | det[1] = "This was our primary target. Read our wiki to find out more!"; | ||
| - | det[2] = " | + | det[2] = "Detecting HIV Protease with our system could be a quick, simple and cheap alternative way to diagnose HIV."; |
| - | det[3] = " | + | det[3] = "Currently, a lumbar puncture is necessary to diagnose the devastating Chagas' disease. However, a simple blood test could test for a specific protease called cruzipain which is produced by the Trypanasoma cruzi parasite."; |
| - | det[4] = " | + | det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting."; |
det[5] = "test5"; | det[5] = "test5"; | ||
var prefix = "blank"; | var prefix = "blank"; | ||
| Line 27: | Line 27: | ||
var cleavage = new Array(); | var cleavage = new Array(); | ||
cleavage[1] = "AGCTGGCCTCTT"; | cleavage[1] = "AGCTGGCCTCTT"; | ||
| - | cleavage[2] = " | + | cleavage[2] = "TCTCAAAACTACCCTATCGTTCAA"; |
| - | cleavage[3] = " | + | cleavage[3] = "AAAAAAGTTAAAGCTAAAAAA"; |
| - | cleavage[4] = " | + | cleavage[4] = "ATCGACGGACGT"; |
cleavage[5] = "blank"; | cleavage[5] = "blank"; | ||
var aip = "GAA ATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | var aip = "GAA ATGCGCCTTAGCAAATTCTTCAGGGACTTCATTCTTCAAAGGAAAAAA"; | ||
| Line 94: | Line 94: | ||
|- | |- | ||
|style="width:860px;background:#d5d5d5;border: solid 20px #d5d5d5;" colspan="3"|'''<html> | |style="width:860px;background:#d5d5d5;border: solid 20px #d5d5d5;" colspan="3"|'''<html> | ||
| - | <div id="sequenceout"><span id="stem">Awaiting sequence generation... </span><span id="spre" style="color:#F6CF39"> | + | <div id="sequenceout"><span id="stem">Awaiting sequence generation... </span><span id="spre" style="color:#F6CF39"></span><span id="spro" style="color:#FC8E42"></span><span id="srbs" style="color:#D34649"></span><span id="scwb" style="color:#AB6197"></span><span id="slin" style="color:#6273A8"></span><span id="scle" style="color:#6A9ECD"></span><span id="saip" style="color:#68904E"></span><span id="ster" style="color:#9DB742"></span><span id="ssuf" style="color:#F6CF39"></span></div> |
</html>''' | </html>''' | ||
|- | |- | ||
Revision as of 10:35, 20 October 2010
| Software Tool |
| We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct. |
| Select Protease | Description | |
|
This was our primary target. Read our wiki to find out more! | ||
|
Awaiting sequence generation...
| ||
|
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator | ||
