Team:Heidelberg/Project/miMeasure
From 2010.igem.org
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
||
Line 42: | Line 42: | ||
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA | ||
|- | |- | ||
- | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9- | + | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG |
|- | |- | ||
- | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9- | + | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT |
|- | |- | ||
- | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G |
|- | |- | ||
- | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A |
|- | |- | ||
- | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11|| | + | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A |
|- | |- | ||
- | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16- | + | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG |
|- | |- | ||
|-||miMeasure without any binding site||NC (negative control) | |-||miMeasure without any binding site||NC (negative control) |
Revision as of 12:23, 27 October 2010
|
|
||||||||||||||||||||||||||||||||||||||||||