Team:Harvard/color/2010.igem.org/Team:Harvard/c1

From 2010.igem.org

(Difference between revisions)
 
Line 15: Line 15:
ATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATAT
ATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATAT
AGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGACTAGTA
AGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGACTAGTA
-
GCGGCCGCTGCAG
+
GCGGCCGCTGCAG<br/><br/>
 +
<a href="http://2010.igem.org/Team:Harvard/color/parts">back to color parts</a>
</div>
</div>

Latest revision as of 00:47, 25 October 2010



C1 Sequence

GAATTCGCGGCCGCATCTAGACCCACAAACACACGCTCGGACGCATATTACACATGTTCATAC ACTTAATACTCGCTGTTTTGAATTGATGTTTTAGGAATATATATGTAGAATACGGGTTACTAC GAAGTTTTCACAGGTCGTGATATGATTCAATTAGCTTCCGACTCATTCATCCAAATACCGAGT CGCCAAAATTCAAACTAGACTCGTTAAATGAATGAATGATGCGGTAGACAAATTGGATCATTG ATTCTCTTTGATAACTTCCTAGTAACCCGCATTCTCTCTTTTGTATTCCAATTTTCTTGATTA ATCTTTCCTGCACAAAAACATGCTTGATCCACTAAGTGACATATATGCTGCCTTCGTATATAT AGTTCTGGTAAAATTAACATTTTGGGTTTATCTTTATTTAAGGCATCGCCATGGGGACTAGTA GCGGCCGCTGCAG

back to color parts