Team:Baltimore US/Project

From 2010.igem.org

Revision as of 02:58, 28 October 2010 by Pon (Talk | contribs)
TitleBarBalti US.png
Home Team Official Team Profile Project Submitted Parts Modeling Notebook Meeting/Lab Times Safety


DIY-GEM: a path towards low cost high throughput gene synthesis.

Synthetic biology research requires more cost effective approaches toward reagents and hardware accessibility. We are developing low-cost alternatives to existing hardware and enzymes in an attempt to expand participation in biological research and development. Our project expands the accessibility of Taq Polymerase by engineering it in a form compatible with BioBrick assembly. This allows use of the over-expressed enzyme from a crude bacterial extract in a PCR reaction at a fraction of the cost of highly purified commercial enzyme. In addition, we have developed inexpensive and easily assembled lab equipment such as a gel electrophoresis apparatus and a PCR thermal cycler. Enabling researchers to synthesize their own enzymes and having access to inexpensive tools will allow for increased participation among the DIY-bio community, stretch increasingly scarce educational funds, and allow rapid scale up of large scale gene synthesis projects."

Developing low-cost alternatives to existing enzymes: Taq polymerase Project Details

We wished to insert Taq Polymerase into a standard BioBrick vector. If this part should prove useful to other teams as an element of a rational design, we must ensure that no sites for the standard BioBrick restriction enzymes exist within the part itself, otherwise the part would shear upon assembly.


We examined the Taq sequenceand exported the SEQ into Plasma DNA. Plasma DNA is free software from University of Helsinki which provides quick analysis of plasmid sequence information. In particular, we obtained a restriction map which identified potential EcoRI, Xbe1, Sbe1, or Pst1 sites within the coding sequence. Here we encountered our first difficulty.

Problem: a PstI restriction site within the coding sequence

At 1717nt, we discovered a restriction site for Pst1: CTGCAG-PstI restriction site
GACGTC-Complement
Solution - Site-specific Mutagenesis by Overlap Extension (see Sambrook, Joseph; Russell, David W. ; Molecular Cloning: A Laboratory Manual, 3rd Edition)

We then used the Gene Designer 2.0 from DNA2.0 to analyze the open reading frames and examine the codons within the PstI restriction site. We find that the first three are coding for leucine with CTG and can be changed at one point to CTT without sacrificing functional integrity in the manufactured enzyme.

Primer Design

We designed a primer pair in order to induce point-mutagenesis at the Pst1 restriction site, flanking the base pair to be altered by 14 nt. with changed Amino Acid Bp's Targeting initial Leucine at G of CTG to CTT. Point mutation Original G in CTG of Leucine. Change of one base to CTT maintains Leucine integrity.

GTGGAGAAGATCCT(T)CAGTACCGGCGG
CACCTCTTCTAGGA(A)GTCATGGCCGCC

While we're designing primers, besides the point mutation, we'll take the opportunity to design and order the primers for the Bb Suffix and Prefix. We'll follow the examples laid out in the Registry of Standard Parts under Promoter Construction for designing the oligos needed to make a part. (http://partsregistry.org/Help:Promoters/Construction)

Important considerations are Melting Point and percentage CG complements. Other considerations are dimerizations, that might cause primers to hairpin. We analyzed these primers using the OligoAnalyzer at IDT. When analyzing PolI Complements only were used for sequence inquiry, not the Bb Suffix/Prefixes. (http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/)

PolI Coli Primers For Overlap Extension PCR

PCR Reaction 1

Bb Prefix + PolI (Fwd Complement) : (Forward complement will begin coding at 121 according to BLAST CDS information.)
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG-ATGCTGCCCCTCTTTGAGCC
60.5 c ; 56.5 % GC Concetration

TAQ Rm
CTCCCGGTACTGAAGGATCTTCTCCAC
61.5 c ; 55.6 % GC Concentration

PCR Reaction - 2

TAQ Fm
GTGGAGAAGATCCTTCAGTACCGGGAG
61.5 c; 55.6 % GC

Bb Suffix + PolI (Reverse Complement) : (Reverse complement will end coding at 2619 according to Blast CDS information.
GTTTCTTCCTGCAGCGGCCGCTACTAGTA-TCACTCCTTGGCGGAGAGCC
61.8 c; 65 % GC

PCR Reaction - 3
Bb Prefix & Suffix Primers

Resuspend in 100 uL of H2O
Run PCR w 1/100 dilutions for PCR (5-10 uL per PCR reaction)

NEXT
- Create Full Bb Prmr w Plasmid combining new part using

<partinfo>R0010</partinfo> - Promoter (LacI)
<partinfo>B0034</partinfo> - Strong RBS
NEW PART - PolI Bb Format
<partinfo>B0015</partinfo> - Double Terminator
Psb1_?_3 - Plasmid of Interest with Chosen Resistance : http://partsregistry.org/Plasmid_backbones



<partinfo>R0010</partinfo> + <partinfo>B0034</partinfo> = New part LacI Promoter + Strong RBS

Cut <partinfo>R0010</partinfo> w/EcoRI & SpeI
Cut <partinfo>B0034</partinfo> w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI) - Because

---
New Part + <partinfo>B0015</partinfo> = New Part

Cut New Part w/EcoRI & SpeI
Cut <partinfo>B0015</partinfo> w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI)




Cut 1st Combined Part w/EcoRI & SpeI
Cut 2nd Combined Part w/XbeI & PstI

Combine in Ampecillan/Kanamyacin Resistan Plasmid (cut w/EcoRI & PstI)

Voila!!! Brand New Taq Polymerase Bb Part.

Developing low-cost alternatives to existing hardware: Project Details and Results

An unfortunate fact of reality is that precision lab equipment is very costly. Even simple devices such as an Electrophoresis or PCR have significant cost. To ameliorate this a portion of our project will involve designing biological tools that are easy to build and are economical.

Baltimore US System.JPG
Our design incorporates two devices, a PCR and an Electrophoresis. Both are controlled by the same control electronics and power supply. A basic overview of the design can be seen in the diagram above. This design allows precise control from a computer or manual control from the control panel on the control electronics. Additionally multiple Electrophoresis devices can be controlled simultaneously in parallel and any power supply suitable can be used to power the devices.

EP.jpg
With regards to equipment, we have successfully constructed a very low-cost Gel Electrophoresis device and are currently working on the control software and control electronics. Additionally, we are working on getting a low-cost PCR thermocycler up and running as well.
Instructions and Design files for building an Electrophoresis device