Team:Baltimore US/Project

From 2010.igem.org

Home Team Official Team Profile Project Submitted Parts Modeling Notebook Meeting/Lab Times Safety


DIY-GEM: a path towards low cost high throughput gene synthesis.

Synthetic biology research requires more cost effective approaches toward reagents and hardware accessibility. We are developing low-cost alternatives to existing hardware and enzymes in an attempt to expand participation in biological research and development. Our project expands the accessibility of Taq Polymerase by engineering it in a form compatible with BioBrick assembly. This allows use of the over-expressed enzyme from a crude bacterial extract in a PCR reaction at a fraction of the cost of highly purified commercial enzyme. In addition, we have developed inexpensive and easily assembled lab equipment such as a gel electrophoresis apparatus and a PCR thermal cycler. Enabling researchers to synthesize their own enzymes and having access to inexpensive tools will allow for increased participation among the DIY-bio community, stretch increasingly scarce educational funds, and allow rapid scale up of large scale gene synthesis projects."

Developing low-cost alternatives to existing enzymes: Taq polymerase Project Details

We wished to insert Taq Polymerase into a standard BioBrick vector. If this part should prove useful to other teams as an element of a rational design, we must ensure that no sites for the standard BioBrick restriction enzymes exist within the part itself, otherwise the part would shear upon assembly.


We examined the Taq sequenceand exported the SEQ into Plasma DNA. Plasma DNA is free software from University of Helsinki which provides quick analysis of plasmid sequence information. In particular, we obtained a restriction map which identified potential EcoRI, Xbe1, Sbe1, or Pst1 sites within the coding sequence. Here we encountered our first difficulty.

Problem: a PstI restriction site within the coding sequence

At 1717nt, we discovered a restriction site for Pst1:

 ...CTGCAG...  PstI restriction site
...GACGTC... Complement

We attempted to eliminate the restriction site by employing a site-specific mutagenesis by overlap extension protocol (see Sambrook, Joseph; Russell, David W. ; Molecular Cloning: A Laboratory Manual, 3rd Edition).

We then used the Gene Designer 2.0 from DNA2.0 to analyze the open reading frames and examine the codons within the PstI restriction site. We find that the first three code for leucine with CTG; we can substitute the final base pair to yield CTT without sacrificing functional integrity in the manufactured enzyme.

Primer Design

We designed a primer pair in order to induce point-mutagenesis at the Pst1 restriction site, flanking the base pair to be altered by 14 nt:

GTGGAGAAGATCCT(T)CAGTACCGGCGG
CACCTCTTCTAGGA(A)GTCATGGCCGCC

While we designed the point-mutagenesis primers, we took the opportunity to design and order the primers for the BioBrick Suffix and Prefix. We followed the examples laid out in the Registry of Standard Parts for designing the oligos needed to make a part. Important considerations are melting point and CG concentration, as well as self-dimerizations and hairpins. We analyzed these primers using the OligoAnalyzer from IDT. When analyzing PolI, only the coding seuence itself was used for sequence inquiry, not the BioBrick Suffix/Prefixes.

PolI Coli Primers For Overlap Extension PCR

PCR Reaction 1

Bb Prefix + PolI (Fwd Complement) : (Forward complement will begin coding at 121 according to BLAST CDS information.)
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG-ATGCTGCCCCTCTTTGAGCC
60.5 c ; 56.5 % GC Concetration

TAQ Rm
CTCCCGGTACTGAAGGATCTTCTCCAC
61.5 c ; 55.6 % GC Concentration

PCR Reaction - 2

TAQ Fm
GTGGAGAAGATCCTTCAGTACCGGGAG
61.5 c; 55.6 % GC

Bb Suffix + PolI (Reverse Complement) : (Reverse complement will end coding at 2619 according to Blast CDS information.
GTTTCTTCCTGCAGCGGCCGCTACTAGTA-TCACTCCTTGGCGGAGAGCC
61.8 c; 65 % GC

PCR Reaction - 3
Bb Prefix & Suffix Primers

Resuspend in 100 uL of H2O
Run PCR w 1/100 dilutions for PCR (5-10 uL per PCR reaction)

NEXT
- Create Full Bb Prmr w Plasmid combining new part using

BBa_R0010 - Promoter (LacI)
BBa_B0034 - Strong RBS
NEW PART - PolI Bb Format
BBa_B0015 - Double Terminator
Psb1_?_3 - Plasmid of Interest with Chosen Resistance : http://partsregistry.org/Plasmid_backbones



BBa_R0010 + BBa_B0034 = New part LacI Promoter + Strong RBS

Cut BBa_R0010 w/EcoRI & SpeI
Cut BBa_B0034 w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI) - Because

---
New Part + BBa_B0015 = New Part

Cut New Part w/EcoRI & SpeI
Cut BBa_B0015 w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI)




Cut 1st Combined Part w/EcoRI & SpeI
Cut 2nd Combined Part w/XbeI & PstI

Combine in Ampecillan/Kanamyacin Resistan Plasmid (cut w/EcoRI & PstI)

Voila!!! Brand New Taq Polymerase Bb Part.

Developing low-cost alternatives to existing hardware: Project Details and Results

An unfortunate fact of reality is that precision lab equipment is very costly. Even simple devices such as an Electrophoresis or PCR have significant cost. To ameliorate this a portion of our project will involve designing biological tools that are easy to build and are economical.


Our design incorporates two devices, a PCR and an Electrophoresis. Both are controlled by the same control electronics and power supply. A basic overview of the design can be seen in the diagram above. This design allows precise control from a computer or manual control from the control panel on the control electronics. Additionally multiple Electrophoresis devices can be controlled simultaneously in parallel and any power supply suitable can be used to power the devices.


With regards to equipment, we have successfully constructed a very low-cost Gel Electrophoresis device and are currently working on the control software and control electronics. Additionally, we are working on getting a low-cost PCR thermocycler up and running as well.
Instructions and Design files for building an Electrophoresis device