User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 12:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer7 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">GCTTCGGGGCAAGGCCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:28, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer6 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">GGATCCTTTATGACCTAATTTAG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:11, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:10, 18 August 2010 (diff | hist) N File:Christina.jpg (top)
- 12:07, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Christina (New page: {{:Team:LMU-Munich/Templates/Page Header}} Christina Krönauer ==Contact Info== *Christina Krönauer *Ludwig Maximilians University (LMU) ==Education== ...) (top)
- 12:02, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer5 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGATCG <font color="#009933">G</font>ATTCC <font color="#009933">G</font>GCAGTAGCAGGTGCTGGTGC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:00, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer4 (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTGC <font color="#009933">C</font>GGAAT <font color="#009933">C</font>CGATCCATATGAGCTGGAGTTCG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 11:58, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGATGAATTGTACAAATC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 11:57, 18 August 2010 (diff | hist) N File:PCR8.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR7b.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR7a.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR6.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR5.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR4b.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR4a.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR3.jpg (top)
- 11:54, 18 August 2010 (diff | hist) N File:PCR2b.jpg (top)
- 11:54, 18 August 2010 (diff | hist) N File:PCR2a.jpg (top)
- 11:49, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer2 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">CCGCGGAGGCTGGATCG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 11:36, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:40, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer1 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">CTCGAGTTTACCACTCCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:36, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:34, 18 August 2010 (diff | hist) N File:PCR1.jpg (top)
- 10:30, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:30, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 10:20, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 10:17, 18 August 2010 (diff | hist) N File:Benny.jpg (top)
- 10:16, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Benny
- 10:16, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Benny (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Benny Clanner *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Ch...)
- 09:59, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 09:58, 18 August 2010 (diff | hist) N File:Emanuel.jpg (top)
- 09:58, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Emanuel (New page: {{:Team:LMU-Munich/Templates/Page Header}} Emanuel Stiegler ==Contact Info== *Emanuel *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Bio...) (top)
- 09:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 09:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 09:27, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 09:26, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 09:24, 18 August 2010 (diff | hist) N File:TeamLMU.JPG (top)
- 09:07, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 09:07, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 09:06, 18 August 2010 (diff | hist) N File:Julia3.jpg (top)
- 09:04, 18 August 2010 (diff | hist) N File:Julia2.jpg (top)
- 09:04, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Julia (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Julia Bartels *Ludwig Maximilians University (LMU) ==Education== * 2011 (expecte...) (top)
- 08:50, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 07:22, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 07:22, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 18:45, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 18:37, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 18:37, 17 August 2010 (diff | hist) N File:17.8.2010 PCR6.jpg (top)
- 18:26, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 18:24, 17 August 2010 (diff | hist) N File:17.8.2010PCR6.jpg (top)
- 16:42, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 16:34, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences (top)
- 16:34, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences
- 16:33, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences (top)
- 16:33, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences
- 16:32, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences
- 16:29, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences
- 16:23, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up
- 16:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 15:21, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up
- 15:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up
- 15:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up
- 15:19, 17 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>Gel extraction or PCR Clean Up</b> Source:http://www.biodee.net/UploadFile/Up-2009-11-26_633948249752287808-a9281.pdf <b>Gel Slice and PCR Pr...)
- 15:16, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 14:54, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:53, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:49, 17 August 2010 (diff | hist) N File:Metabion.jpg (top)
- 14:46, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:45, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:44, 17 August 2010 (diff | hist) N File:Fermentas.gif
- 14:41, 17 August 2010 (diff | hist) N File:Gbo logo.png (top)
- 14:40, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:11, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:10, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:09, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:08, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:07, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:04, 17 August 2010 (diff | hist) Team:LMU-Munich
- 14:01, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:57, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:56, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:53, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:52, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:50, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:44, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:44, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:42, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:41, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:40, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:35, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:34, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:33, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:30, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:29, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:28, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:21, 17 August 2010 (diff | hist) Team:LMU-Munich
- 13:18, 17 August 2010 (diff | hist) N File:Eurofins.jpg (top)
- 13:13, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 13:12, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 13:10, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis
- 13:09, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis
- 13:07, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis
- 13:06, 17 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis (New page: 1kb DNA Ladder used from Promega)
- 13:04, 17 August 2010 (diff | hist) N File:DNALadder.gif (top)
- 13:01, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 12:55, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:55, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:54, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:53, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:52, 17 August 2010 (diff | hist) N File:17 8 10 2 apo.jpg (top)
- 12:51, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:50, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:49, 17 August 2010 (diff | hist) File:17 8 10 1 apo.jpg (uploaded a new version of "Image:17 8 10 1 apo.jpg") (top)
- 12:46, 17 August 2010 (diff | hist) N File:17 8 10 1 apo.jpg
- 12:45, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 12:39, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 09:43, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu (top)
- 18:49, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu
- 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu
- 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu
- 18:46, 16 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source: Promega Usage Information for the Pfu Polymerase In a sterile, nuclease free PCR-tube mix following components: {| |- |Component |Volume...)
- 18:31, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 18:27, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:26, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:25, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:24, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:22, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:20, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:18, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:17, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:16, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 18:07, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 17:57, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 17:52, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-15-2010)
- 17:52, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-14-2010)
- 20:28, 14 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 20:04, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis
- 14:47, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 14:02, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 14:02, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 14:01, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 13:57, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 13:21, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence (→Measurement of competence) (top)
- 13:21, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence (→Measurement of competence)
- 13:20, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence (→Measurement of competence)
- 13:19, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/8 SOC medium (top)
- 13:17, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/8 SOC medium (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source: http://partsregistry.org/SOC == Summary == SOC Medium. Used in bacterial transformation. == Ingredients == *SOB *20 mM glucose ==...)
- 13:16, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:15, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source:http://partsregistry.org/Help:Protocols/Competent_Cells ===Measurement of competence=== * Transform 50 μl of cells with 1 μl of stan...)
- 13:13, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:12, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells
- 13:11, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/6 SOB medium (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source:http://partsregistry.org/SOB == Summary == SOB Medium. Used in growing bacteria for preparing chemically competent cells == Ingredients...) (top)
- 13:09, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:07, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells
- 12:57, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-10-2010)
- 12:56, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 12:55, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 12:53, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 12:53, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 12:52, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 12:52, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 12:50, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-10-2010)
- 12:48, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-10-2010)
- 12:47, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis
- 11:15, 12 August 2010 (diff | hist) Team:LMU-Munich/Pathway
- 08:36, 12 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/4 Plasmid extraction from cells (top)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)