Team:Kyoto/Parts

From 2010.igem.org

(Difference between revisions)
(→K358001)
Line 5: Line 5:
<groupparts>iGEM010 Kyoto</groupparts>
<groupparts>iGEM010 Kyoto</groupparts>
-
====<partinfo>K358000</partinfo>: Lac promoter with GFP====
+
====[http://partsregistry.org/Part:BBa_K358000 BBa_K358000]: Lac promoter with GFP====
-
The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5.
+
The lac promoter will be repressed and not induce GFP in the presence of ''lac''I. We measured the strength of fluorescence with low copy plasmid vector, [http://partsregistry.org/Part:pSB4K5 pSB4K5].
====[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard====
====[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard====
-
constitutive promoter[J23101] with GFP on low plasmid[pSB4K5]
+
Constitutive promoter [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] with GFP on low plasmid [http://partsregistry.org/Part:pSB4K5 pSB4K5].
-
====<partinfo>K358004</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358004 BBa_K358004]: lambda lysis cassette[SRRz/Rz1]====
-
<partinfo>BBa_K358004 short</partinfo>
+
This part causes cell death.  It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes.
-
This part causes cell death. It contains holin/antiholin, endolysin and Rz/Rz1 genes.
+
====[http://partsregistry.org/Part:BBa_K358006 BBa_K358006]: lambda lysis cassette with terminator====
 +
&lambda; lysis cassette [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] with double terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015].
-
====<partinfo>K358006</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358010 BBa_K358010]: anti-killer gene with GFP====
-
<partinfo>BBa_K358006 short</partinfo>
+
It codes S<sub>&Delta;TMD1</sub> as the anti-killer gene, which is derived from &lambda; phage DNA and against the lambda lysis cassette[ [http://partsregistry.org/Part:BBa_K358005 BBa_K358005] ]: the killer gene.
-
&lambda; lysis cassette <partinfo>BBa_K358004</partinfo> with double terminator <partinfo>BBa_B0015</partinfo>.
+
====[http://partsregistry.org/Part:BBa_K358012 BBa_K358012]: S<sub>&Delta;TMD1</sub>====
 +
S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains.
 +
This S<sub>&Delta;TMD1</sub>, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene.
-
====<partinfo>K358010</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358013 BBa_K358013]: S<sub>&Delta;TMD1</sub> with terminator====
-
<partinfo>BBa_K358010 short</partinfo>
+
S<sub>&Delta;TMD1</sub> with double terminator.
-
It codes S<sub>&Delta;TMD1</sub> as the anti-killer gene, which is derived from &lambda; phage DNA and against the lambda lysis cassette[BBa_K358005]: the killer gene.
+
====[http://partsregistry.org/Part:BBa_K358015 BBa_K358015]: pLac+anti-killer gene====
 +
The anti-killer gene with GFP [http://partsregistry.org/Part:BBa_K358010 BBa_K358010] is expressed under the control of lac promoter.
-
====<partinfo>K358012</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358016 BBa_K358016]: pLac+anti-killer gene+pConst====
-
====<partinfo>K358013</partinfo>====
+
pLac+anti-killergene+pConst.
-
====<partinfo>K358015</partinfo>====
+
 
-
====<partinfo>K358016</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358017 BBa_K358017]: low promoter+anti-killer gene====
-
====<partinfo>K358017</partinfo>====
+
Low constitutive promoter [J23105] and anti-killer gene [http://partsregistry.org/Part:BBa_K358010 BBa_K358010].
-
====<partinfo>K358018</partinfo>====
+
 
-
====<partinfo>K358019</partinfo>====
+
====[http://partsregistry.org/Part:BBa_K358018 BBa_K358018]: Low promoter+anti-killergene+lacP====
-
====<partinfo>K358020</partinfo>====
+
Constitutive promoter [http://partsregistry.org/Part:BBa_J23105 BBa_J23105] + anti-killergene [http://partsregistry.org/Part:BBa_358010 BBa_358010] + lactose promoter [http://partsregistry.org/Part:BBa_R0011 BBa_R0011].
-
====<partinfo>K358021</partinfo>====
+
 
 +
====[http://partsregistry.org/Part:BBa_K358019 BBa_K358019]: Lysis cassette regulated by lacP====
 +
Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis.  So, lactose promoter must be repressed when transform this part.
 +
 
 +
To repress lactose promoter tightly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX, not TOP10.  KRX has lacI in its genome and TOP10 hasn't (see genotype [http://www.promega.com/pnotes/94/14410_27/14410_27.pdf], [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29]).
 +
 
 +
====[http://partsregistry.org/Part:BBa_K358020 BBa_K358020]: Lysisbox====
 +
This part consists two module. Constantly expressed killer gene [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter.
 +
 
 +
====[http://partsregistry.org/Part:BBa_K358021 BBa_K358021]: Lysisbox -module2-====
 +
Anti-killergene is induced constitutively and killergene is regulated by lactose promoter.
[[#Top|^Top]]
[[#Top|^Top]]
Line 43: Line 57:
!Name||Description||Well<sup>*1</sup>||Plasmid||Resistance||Insert Length||Vector Length
!Name||Description||Well<sup>*1</sup>||Plasmid||Resistance||Insert Length||Vector Length
|-
|-
-
|<partinfo>J23100</partinfo>||Constitutive promoter family member||1-18-C||<partinfo>J61002</partinfo>||Ampicillin||35||2948
+
|[http://partsregistry.org/Part:BBa_J23100 BBa_J23100]||Constitutive promoter family member||1-18-C||[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]||Ampicillin||35||2948
|-
|-
-
|<partinfo>J23105</partinfo>||Constitutive promoter family member||1-18-M||<partinfo>J61002</partinfo>||Ampicillin||35||2948
+
|[http://partsregistry.org/Part:BBa_J23105 BBa_J23105]||Constitutive promoter family member||1-18-M||[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]||Ampicillin||35||2948
|-
|-
-
|<partinfo>J23116</partinfo>||Constitutive promoter family member||1-20-M||<partinfo>J61002</partinfo>||Ampicillin||35||2948
+
|[http://partsregistry.org/Part:BBa_J23116 BBa_J23116]||Constitutive promoter family member||1-20-M||[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]||Ampicillin||35||2948
|-
|-
-
|<partinfo>R0011</partinfo>||Promoter (''lac''I regulated, lambda pL hybrid)||1-6-G||<partinfo>pSB1A2</partinfo>||Ampicillin||55||2079
+
|[http://partsregistry.org/Part:BBa_R0011 BBa_R0011]||Promoter (''lac''I regulated, lambda pL hybrid)||1-6-G||[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]||Ampicillin||55||2079
|-
|-
-
|<partinfo>B0015</partinfo>||Double terminator (<partinfo>B0010</partinfo>-<partinfo>B0012</partinfo>)||1-23-L||<partinfo>pSB1AK3</partinfo>||Ampicillin, Kanamycin||129||3189
+
|[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]||Double terminator ([http://partsregistry.org/Part:BBa_B0010 BBa_B0010]-[http://partsregistry.org/Part:BBa_B0012 BBa_B0012])||1-23-L||[http://partsregistry.org/Part:BBa_pSB1AK3 BBa_pSB1AK3]||Ampicillin, Kanamycin||129||3189
|-
|-
-
|<partinfo>E0840</partinfo>||GFP generator||1-12-O||<partinfo>pSB1A2</partinfo>||Ampicillin||878||2079
+
|[http://partsregistry.org/Part:BBa_E0840 BBa_E0840]||GFP generator||1-12-O||[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]||Ampicillin||878||2079
|-
|-
-
|<partinfo>E0240</partinfo>||GFP generator||1-12-M||<partinfo>pSB1A2</partinfo>||Ampicillin||876||2079
+
|[http://partsregistry.org/Part:BBa_E0240 BBa_E0240]||GFP generator||1-12-M||[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]||Ampicillin||876||2079
|-
|-
-
|<partinfo>I20260</partinfo>||Measurement Kit Test of <partinfo>J23101</partinfo>||2-17-F||<partinfo>pSB3K3</partinfo>||Kanamycin||919||2750
+
|[http://partsregistry.org/Part:BBa_I20260 BBa_I20260]||Measurement Kit Test of [http://partsregistry.org/Part:BBa_J23101 BBa_J23101]||2-17-F||[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]||Kanamycin||919||2750
|-
|-
-
|<partinfo>J06702</partinfo>||mCherry, bacterial with RBS and forward terminator||2-8-E||<partinfo>pSB1A2</partinfo>||Ampicillin||869||2079
+
|[http://partsregistry.org/Part:BBa_J06702 BBa_J06702]||mCherry, bacterial with RBS and forward terminator||2-8-E||[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]||Ampicillin||869||2079
|-
|-
-
|<partinfo>pSB3K3</partinfo>||RFP Coding Device||1-5-E||<partinfo>pSB3K3</partinfo>||Kanamycin||1069||2750
+
|[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]||RFP Coding Device||1-5-E||[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]||Kanamycin||1069||2750
|-
|-
-
|<partinfo>pSB4K5</partinfo>||Low copy BioBrick standard vector||1-5-G||<partinfo>pSB4K5</partinfo>||Kanamycin||1069||3419
+
|[http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5]||Low copy BioBrick standard vector||1-5-G||[http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5]||Kanamycin||1069||3419
|-
|-
-
|<partinfo>pSB1C3</partinfo>||High copy BioBrick assembly plasmid||||<partinfo>pSB1C3</partinfo>||Chloramphenicol||||2072
+
|[http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3]||High copy BioBrick assembly plasmid||||[http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3]||Chloramphenicol||||2072
|-
|-
|}
|}
Line 74: Line 88:
!Name||Description||Sequence
!Name||Description||Sequence
|-
|-
-
|<partinfo>G00100</partinfo>||Forward primer for sequencing/amplifying BioBrick parts (VF2)||tgccacctgacgtctaagaa
+
|[http://partsregistry.org/Part:BBa_G00100 BBa_G00100]||Forward primer for sequencing/amplifying BioBrick parts (VF2)||tgccacctgacgtctaagaa
|-
|-
-
|<partinfo>G00101</partinfo>||Reverse primer for sequencing/amplifying BioBrick parts (VR)||attaccgcctttgagtgagc
+
|[http://partsregistry.org/Part:BBa_G00101 BBa_G00101]||Reverse primer for sequencing/amplifying BioBrick parts (VR)||attaccgcctttgagtgagc
|}
|}

Revision as of 08:41, 25 October 2010

Contents

Parts

Original

List

<groupparts>iGEM010 Kyoto</groupparts>

[http://partsregistry.org/Part:BBa_K358000 BBa_K358000]: Lac promoter with GFP

The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, [http://partsregistry.org/Part:pSB4K5 pSB4K5].

[http://partsregistry.org/Part:BBa_K358001 BBa_K358001]: Measurement Standard

Constitutive promoter [http://partsregistry.org/Part:BBa_J23101 BBa_J23101] with GFP on low plasmid [http://partsregistry.org/Part:pSB4K5 pSB4K5].

[http://partsregistry.org/Part:BBa_K358004 BBa_K358004]: lambda lysis cassette[SRRz/Rz1]

This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes.

[http://partsregistry.org/Part:BBa_K358006 BBa_K358006]: lambda lysis cassette with terminator

λ lysis cassette [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] with double terminator [http://partsregistry.org/Part:BBa_B0015 BBa_B0015].

[http://partsregistry.org/Part:BBa_K358010 BBa_K358010]: anti-killer gene with GFP

It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette[ [http://partsregistry.org/Part:BBa_K358005 BBa_K358005] ]: the killer gene.

[http://partsregistry.org/Part:BBa_K358012 BBa_K358012]: SΔTMD1

S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. This SΔTMD1, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene.

[http://partsregistry.org/Part:BBa_K358013 BBa_K358013]: SΔTMD1 with terminator

SΔTMD1 with double terminator.

[http://partsregistry.org/Part:BBa_K358015 BBa_K358015]: pLac+anti-killer gene

The anti-killer gene with GFP [http://partsregistry.org/Part:BBa_K358010 BBa_K358010] is expressed under the control of lac promoter.

[http://partsregistry.org/Part:BBa_K358016 BBa_K358016]: pLac+anti-killer gene+pConst

pLac+anti-killergene+pConst.

[http://partsregistry.org/Part:BBa_K358017 BBa_K358017]: low promoter+anti-killer gene

Low constitutive promoter [J23105] and anti-killer gene [http://partsregistry.org/Part:BBa_K358010 BBa_K358010].

[http://partsregistry.org/Part:BBa_K358018 BBa_K358018]: Low promoter+anti-killergene+lacP

Constitutive promoter [http://partsregistry.org/Part:BBa_J23105 BBa_J23105] + anti-killergene [http://partsregistry.org/Part:BBa_358010 BBa_358010] + lactose promoter [http://partsregistry.org/Part:BBa_R0011 BBa_R0011].

[http://partsregistry.org/Part:BBa_K358019 BBa_K358019]: Lysis cassette regulated by lacP

Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part.

To repress lactose promoter tightly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX, not TOP10. KRX has lacI in its genome and TOP10 hasn't (see genotype [http://www.promega.com/pnotes/94/14410_27/14410_27.pdf], [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29]).

[http://partsregistry.org/Part:BBa_K358020 BBa_K358020]: Lysisbox

This part consists two module. Constantly expressed killer gene [http://partsregistry.org/Part:BBa_K358004 BBa_K358004] by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter.

[http://partsregistry.org/Part:BBa_K358021 BBa_K358021]: Lysisbox -module2-

Anti-killergene is induced constitutively and killergene is regulated by lactose promoter.

^Top

BioBrick

Parts

NameDescriptionWell*1PlasmidResistanceInsert LengthVector Length
[http://partsregistry.org/Part:BBa_J23100 BBa_J23100]Constitutive promoter family member1-18-C[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]Ampicillin352948
[http://partsregistry.org/Part:BBa_J23105 BBa_J23105]Constitutive promoter family member1-18-M[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]Ampicillin352948
[http://partsregistry.org/Part:BBa_J23116 BBa_J23116]Constitutive promoter family member1-20-M[http://partsregistry.org/Part:BBa_J61002 BBa_J61002]Ampicillin352948
[http://partsregistry.org/Part:BBa_R0011 BBa_R0011]Promoter (lacI regulated, lambda pL hybrid)1-6-G[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]Ampicillin552079
[http://partsregistry.org/Part:BBa_B0015 BBa_B0015]Double terminator ([http://partsregistry.org/Part:BBa_B0010 BBa_B0010]-[http://partsregistry.org/Part:BBa_B0012 BBa_B0012])1-23-L[http://partsregistry.org/Part:BBa_pSB1AK3 BBa_pSB1AK3]Ampicillin, Kanamycin1293189
[http://partsregistry.org/Part:BBa_E0840 BBa_E0840]GFP generator1-12-O[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]Ampicillin8782079
[http://partsregistry.org/Part:BBa_E0240 BBa_E0240]GFP generator1-12-M[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]Ampicillin8762079
[http://partsregistry.org/Part:BBa_I20260 BBa_I20260]Measurement Kit Test of [http://partsregistry.org/Part:BBa_J23101 BBa_J23101]2-17-F[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]Kanamycin9192750
[http://partsregistry.org/Part:BBa_J06702 BBa_J06702]mCherry, bacterial with RBS and forward terminator2-8-E[http://partsregistry.org/Part:BBa_pSB1A2 BBa_pSB1A2]Ampicillin8692079
[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]RFP Coding Device1-5-E[http://partsregistry.org/Part:BBa_pSB3K3 BBa_pSB3K3]Kanamycin10692750
[http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5]Low copy BioBrick standard vector1-5-G[http://partsregistry.org/Part:BBa_pSB4K5 BBa_pSB4K5]Kanamycin10693419
[http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3]High copy BioBrick assembly plasmid[http://partsregistry.org/Part:BBa_pSB1C3 BBa_pSB1C3]Chloramphenicol2072
  • *1 "1-18-C" means well 18C in [http://partsregistry.org/Help:Spring_2010_DNA_distribution Spring 2010 DNA Distribution Kit] Plate 1.

Primers

NameDescriptionSequence
[http://partsregistry.org/Part:BBa_G00100 BBa_G00100]Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaa
[http://partsregistry.org/Part:BBa_G00101 BBa_G00101]Reverse primer for sequencing/amplifying BioBrick parts (VR)attaccgcctttgagtgagc

^Top

Retrieved from "http://2010.igem.org/Team:Kyoto/Parts"