Team:Imperial College London/Software Tool

From 2010.igem.org

(Difference between revisions)

Revision as of 11:23, 20 October 2010

Department of Bioengineering

Division of Molecular Biosciences

Software Tool

We realised early on that our detection module could be designed with a sensitivity to different proteases. By changing the cleavage site the system can accept a wide variety of inputs. This tool is designed to facilitate a quick custom sequence generation of the entire surface protein construct.

Select Protease		Description
		This was our primary target. Read our wiki to find out more!
Awaiting sequence generation...
Yellow - Biobrick Prefix/Suffix Orange - Promoter Red - Ribosome Binding Site Purple - Cell Wall Binding Domain Dark Blue - Adjustable Linker Light Blue - Protease Cleavage Site Dark Green - Autoinducing Peptide Light Green - Terminator

@@ Line 19: / Line 19: @@
    det[3] = "Currently, a lumbar puncture is necessary to diagnose the devastating Chagas' disease. However, a simple blood test could test for a specific protease called cruzipain which is produced by the Trypanasoma cruzi parasite.";
    det[4] = "Detecting this coagulation factor could be a way of determining if patients should be given warfarin or a low molecular weight heparin (LMWH) if they are displaying atrial fibrilation following a stroke. Factor X is the first member of the thrombin pathway which essentially leads to blood clotting.";
-   det[5] = "test5";
+   det[5] = "The complement system is part of the innate immune response to an acute infection. Detecting C3 convertase could give medical professionals a rapid method of seeing if a patient is fighting an acute infection.";
    var prefix = "GAATTCGCGGCCGCTTCTAG";
    var promoter = "blank";