Team:ESBS-Strasbourg/Results/Biobricks

From 2010.igem.org

Revision as of 19:44, 24 October 2010 by Georgio (Talk | contribs)

{|

ESBS - Strasbourg



Biobricks

Parts Submitted to Registry


      

Part Number: Part Name: Plasmid/Resistance Status
BBa_K365000 Phytochrome Interacting Factor-3 (PIF3) pSB1C3 / Chloramphenicol Sequenced
BBa_K365001 Phytochrome Interacting Factor-6 (PIF6) pSB1C3 / Chloramphenicol Sequenced
BBa_K365002 Phytochrome B (aa 1-908) pSB1C3 / Chloramphenicol Sequenced
BBa_K365003 Phytochrome B (aa 1-642) pSB1C3 / Chloramphenicol Sequenced
BBa_K365004 ∆N-ClpX (aa 61-425) pSB1C3 / Chloramphenicol Sequenced
BBa_K365005 Linker (aa 20) pSB1C3 / Chloramphenicol Sequenced
BBa_K365006 LAA tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365007 DAS tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365008 Lambda tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365009 GFP (super fold) pSB1C3 / Chloramphenicol Sequenced
BBa_K365010 PhyB642-(linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced
BBa_K365011 PhyB908-(linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced
BBa_K365012 Full-length ClpX pSB1C3 / Chloramphenicol Sequenced
BBa_K365013 ∆NClpX-linker-∆NClpX-linker-∆NClpX pSB1C3 / Chloramphenicol Sequenced
BBa_K365014 (linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced


Phytochrome Interacting Factor-3 (PIF3) - BBa_K365000


Background:

PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.

Conception:

The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 (Lim & Voigt, 2009.)
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.
PIF3

The plasmid containing the PIF3-sequence was provided by the laboratory of Stephan Kircher from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 51 bp
GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC



Reverse primer (5’->3’): 51 bp
ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC



In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’) (24 bp)
GCAAACTCTTCAAGAGCTAGAGAG

Reverse primer (5’->3’) (24 bp)
CTCTCTAGCTCTTGAAGAGTTTGC

Phytochrome Interacting Factor-6 (PIF6) - BBa_K365001


Background:

For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, (Lim & Voigt, 2009.) screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to coexpressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane.

Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF
pairs in a fluorescence translocation assay.


Conception: We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by (Lim & Voigt, 2009.).

PIF6


The plasmid containing the PIF6-sequence was provided by the laboratory of Wilfried Weber) from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 54 bp
GGATCCgaattcgcggccgcttctagatggccggcATGATGTTCTTACCAACCG

Reverse primer (5’->3’): 58 bp
CAGCTGctgcagcggccgctactagtattaaccggtGTCAACATGTTTATTGCTTTCC

Phytochrome B (aa 1-908) - BBa_K365002


...

Phytochrome B (aa 1-642) - BBa_K365003


...

∆N-ClpX (aa 61-425) - BBa_K365004


...

Linker (aa 20) - BBa_K365005


...

LAA tag - BBa_K365006


...

DAS tag - BBa_K365007


...

Lambda tag - BBa_K365008


...

GFP (super fold) - BBa_K365009


...

PhyB642-(linker-∆NClpX)3 - BBa_K365010




...

PhyB908-(linker-∆NClpX)3 - BBa_K365011


...

Full-length ClpX - BBa_K365012


...

∆NClpX-linker-∆NClpX-linker-∆NClpX - BBa_K365013


...

(linker-∆NClpX)3 - BBa_K365014


...

16


...