Team:Aberdeen Scotland/Parts

From 2010.igem.org

(Difference between revisions)
 
(27 intermediate revisions not shown)
Line 2: Line 2:
{{:Team:Aberdeen_Scotland/Title}}
{{:Team:Aberdeen_Scotland/Title}}
<html>
<html>
 +
<h1>Parts Submitted to the Registry</h1>
</html>
</html>
 +
 +
== '''[http://partsregistry.org/Part:BBa_K385002  Part:BBa_K385002]:    Phage MS2 coat protein''' ==
 +
 +
'''Length''':    414 bp
 +
 +
'''Part type''': coding
 +
 +
 +
'''Part information'''
 +
 +
This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.
 +
 +
 +
'''Sequence'''
 +
 +
Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg
 +
tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc
 +
caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac
 +
 +
 +
'''Design Notes'''
 +
 +
We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 +
 +
'''Source '''
 +
[http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]
 +
 +
== '''[http://partsregistry.org/Part:BBa_K385003  Part:BBa_K385003]:    Phage lambda N-peptide ==
 +
 +
'''Length''':    90 bp
 +
 +
'''Part type''': coding
 +
 +
 +
'''Part information'''
 +
 +
N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.
 +
 +
 +
'''Sequence'''
 +
 +
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac
 +
 +
 +
'''Applications'''
 +
 +
The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.
 +
 +
 +
'''Design Notes'''
 +
 +
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 +
 +
'''Source '''
 +
Phage lambda genome
 +
 +
== '''[http://partsregistry.org/Part:BBa_K385004  Part:BBa_K385004]:    Phage lambda N-peptide, tandem repeat  ==
 +
 +
'''Length''':    177 bp
 +
 +
'''Part type''': coding
 +
 +
 +
'''Part information'''
 +
 +
Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop.  [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa%20K385004 confirmed sequence]
 +
 +
 +
'''Sequence'''
 +
 +
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa
 +
cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat
 +
 +
 +
'''Applications'''
 +
 +
The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415.
 +
The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1).
 +
 +
[[Image:PRS415_FLU.jpg|center|800 px]]
 +
 +
A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence.
 +
Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.
 +
 +
 +
'''Design Notes'''
 +
 +
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 +
'''Source '''
 +
Phage lambda genome
 +
 +
== '''[http://partsregistry.org/Part:BBa_K385005  Part:BBa_K385005]:    B-box sequence encoding a regulatory mRNA stem loop  ==
 +
 +
'''Length''': 56 bp
 +
 +
'''Part type''': Regulatory
 +
 +
 +
'''Part information'''
 +
 +
This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR.
 +
 +
 +
'''Sequence'''
 +
 +
attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat
 +
 +
 +
'''Source '''
 +
Phage lambda genome
 +
<html>
 +
<br><br>
 +
<hr>
 +
<table class="nav">
 +
<tr>
 +
<td>
 +
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a>
 +
</td>
 +
<td align="right">
 +
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Modeling">Continue to the Modelling Summary&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a>
 +
</td>
 +
</tr>
 +
</table>
 +
</html>
 +
{{:Team:Aberdeen_Scotland/Footer}}

Latest revision as of 15:57, 27 October 2010

University of Aberdeen - ayeSwitch - iGEM 2010

Parts Submitted to the Registry

Contents

Part:BBa_K385002: Phage MS2 coat protein

Length: 414 bp

Part type: coding


Part information

This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. Sequence analysis has been confirmed.


Sequence

Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac


Design Notes

We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)


Source see NCBI sequence

Part:BBa_K385003: Phage lambda N-peptide

Length: 90 bp

Part type: coding


Part information

N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box Part:BBa_K385005) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Sequence analysis has been confirmed.


Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac


Applications

The Aberdeen 2010 iGEM team has no direct experience of using BBa_K385003, but the closely related part BBa_K385004. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.


Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)


Source Phage lambda genome

Part:BBa_K385004: Phage lambda N-peptide, tandem repeat

Length: 177 bp

Part type: coding


Part information

Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop. confirmed sequence


Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat


Applications

The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415. The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1).

PRS415 FLU.jpg

A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence. Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.


Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)

Source Phage lambda genome

Part:BBa_K385005: B-box sequence encoding a regulatory mRNA stem loop

Length: 56 bp

Part type: Regulatory


Part information

This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers BBa_K385003 and BBa_K385004). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR.


Sequence

attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat


Source Phage lambda genome



Back to the Top