http://2010.igem.org/wiki/index.php?title=Special:Contributions/Kleinsorg&feed=atom&limit=50&target=Kleinsorg&year=&month=2010.igem.org - User contributions [en]2024-03-29T04:50:56ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-28T03:58:27Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
== 02/10/2010 ==<br />
<br /><br />
*digestion in 50 µl of <br />
**4x pSB1C3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
**4x pSB1A3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
<br />
== 05/10/2010 ==<br />
<br /><br />
*1µg digestion of miMeasure and 6 different constructs (1A, 3F, 13, 15, 17, 37) with EcoRI and PstI<br />
<br />
:1= 0S<br />
:2= 0L<br />
:3= 10S<br />
:4= 10L<br />
<br />
<br />
== 06/10/2010 ==<br />
<br />
20 Miniprep:<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: 20 Minis'''<br />
|Number||binding site against miRNA x||Position<br />
|-<br />
|1||221||3.5<br />
|-<br />
|2||221||1.4<br />
|-<br />
|3||1179||3.1<br />
|-<br />
|4||4286||2.6<br />
|-<br />
|5||4286||4.1<br />
|-<br />
|6||4286||3.4<br />
|-<br />
|7||1179||4.4<br />
|-<br />
|8||1179|3.5<br />
|-<br />
|9||1179||1.9<br />
|-<br />
|10||221||4.6<br />
|-<br />
|11||221||1.5<br />
|-<br />
|12||4286||3.5<br />
|-<br />
|13||221||4.8<br />
|-<br />
|14||221||2.3<br />
|-<br />
|15||4286||2.2<br />
|-<br />
|16||4286||1.3<br />
|-<br />
|17||1179||2.5<br />
|-<br />
|18||1179||2.4<br />
|-<br />
|19||1179||1.5<br />
|-<br />
|20||1179||4.8<br />
|}<br />
<br />
* digestion of miMeasure and 6 different synthetic miRNA patterns against endogenous miR122<br />
* gel seperation<br />
* gel purification<br />
* sequencing<br />
----<br />
<br />
<br />
== 12/10/2010 ==<br />
<br />
4 miraPCRs for binding sites of miR4286.<br />
* one PCR with an annealing temperature of 45 degree and 16 cycles<br />
* second miraPCR with annealing temperature of 57 degree and also 16 cycles<br />
**nucleotide removal<br />
**digestion<br />
**gel seperation<br />
**gel purification<br />
**ligation in miMeasure and pSB1C3 <br />
**transformation<br />
<br />
== 13/10/2010 ==<br />
<br />
*pick colonies<br />
*about 8 hours later: do minipreps<br />
*send for sequencing<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
----<br />
<br />
= 14/10/2010 =<br />
* a reasonable<br />
* Screening of 40 colonies of miR4286 (colony PCR)<br />
* Screening of 32 colonies of miR320b (colony PCR)<br />
<br />
<br />
all negative<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 15/10/2010 =<br />
<br />
ligation of miMeasure construct:<br /><br /><br />
<br />
miR-122<br /><br />
miR-122ran<br /><br />
miR-1179<br /><br />
miR-221<br /><br />
<br /><br />
each in 0S/0L/10S/10L versions<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
= 16/10/2010 =<br />
transformation of each ligation to TOP10 ''E.coli''<br />
<br />
cells were plated on LB-amp plates <br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 17/10/2010 =<br />
<br />
96 colony PCRs - 8 from each plate<br />
<br><br />
ALL NEGATIVE!!!!<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:HeidelbergTeam:Heidelberg2010-10-28T03:56:53Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/NivoSlider}}<br />
<html><br />
<br />
<!--<br />
<br />
============================================================================================<br />
*** PLEASE NOTE: ***<br />
<br />
The contents and design of this wiki are published under the GNU Free Documentation License. You are granted the right to copy and modify our work, but you must publish your work under the same type of license while recognizing us the authors.<br />
<br />
Stefan Kleinsorg, Thomas Uhlig<br />
<br />
============================================================================================<br />
<br />
/--><br />
<br />
<style type="text/css"><br />
<br />
#pics {<br />
margin-left:-5px;<br />
margin-right:-5px;<br />
text-align:center;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d2/IGEM_official_gray4.png); <br />
background-repeat: no-repeat;<br />
background-position: center;<br />
}<br />
<br />
.piclinks {<br />
border:none;<br />
text-decoration:none;<br />
position:relative;<br />
z-index:5;<br />
}<br />
<br />
#desc-table {<br />
width:370px;<br />
height:170px;<br />
border: none;<br />
background:transparent;<br />
margin:10px 0px;<br />
} <br />
<br />
#desc {<br />
border: none;<br />
background:transparent;<br />
padding:0px;<br />
text-align:justify;<br />
font-size:12pt;<br />
}<br />
<br />
a { outline:0}<br />
<br />
#wrapperheadline {<br />
position:relative;<br />
font-size: 14pt;<br />
font-weight:bold;<br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var modelarray = new Array();<br />
var teamarray = new Array();<br />
var humanarray = new Array();<br />
var notearray = new Array();<br />
var partsarray = new Array();<br />
var suparray = new Array();<br />
<br />
for (var i = 0; i <= 3; i++) {<br />
modelarray[i] = new Image();<br />
teamarray[i] = new Image();<br />
humanarray[i] = new Image();<br />
notearray[i] = new Image();<br />
partsarray[i] = new Image();<br />
suparray[i] = new Image();<br />
}<br />
<br />
modelarray[1].src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png";<br />
modelarray[2].src="https://static.igem.org/mediawiki/2010/a/a6/Modeling_hover.png";<br />
modelarray[3].src="https://static.igem.org/mediawiki/2010/e/e1/Modeling_down.png";<br />
<br />
teamarray[1].src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png";<br />
teamarray[2].src="https://static.igem.org/mediawiki/2010/d/d2/Team_hover.png";<br />
teamarray[3].src="https://static.igem.org/mediawiki/2010/9/97/Team_down.png";<br />
<br />
humanarray[1].src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png";<br />
humanarray[2].src="https://static.igem.org/mediawiki/2010/1/1e/Human_practices_hover.png";<br />
humanarray[3].src="https://static.igem.org/mediawiki/2010/d/d6/Human_practices_down.png";<br />
<br />
notearray[1].src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png";<br />
notearray[2].src="https://static.igem.org/mediawiki/2010/1/18/Notebook_hover.png";<br />
notearray[3].src="https://static.igem.org/mediawiki/2010/a/a5/Notebook_down.png";<br />
<br />
partsarray[1].src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png";<br />
partsarray[2].src="https://static.igem.org/mediawiki/2010/3/38/Parts_hover.png";<br />
partsarray[3].src="https://static.igem.org/mediawiki/2010/c/c0/Parts_down.png";<br />
<br />
suparray[1].src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png";<br />
suparray[2].src="https://static.igem.org/mediawiki/2010/2/22/Support_hover.png";<br />
suparray[3].src="https://static.igem.org/mediawiki/2010/8/8d/Support_down.png";<br />
<br />
function writeText(txt)<br />
{document.getElementById("desc").innerHTML=txt; }<br />
<br />
function swap(num,effect) {<br />
<br />
switch (num) {<br />
<br />
case 1: document.getElementById("pic"+num).src =modelarray[effect].src;<br />
break;<br />
case 2: document.getElementById("pic"+num).src =teamarray[effect].src;<br />
break;<br />
case 3: document.getElementById("pic"+num).src =humanarray[effect].src;<br />
break;<br />
case 4: document.getElementById("pic"+num).src =notearray[effect].src;<br />
break;<br />
case 5: document.getElementById("pic"+num).src =partsarray[effect].src;<br />
break;<br />
case 6: document.getElementById("pic"+num).src =suparray[effect].src;<br />
break;<br />
}<br />
} <br />
<br />
function mouseOver(num) {<br />
swap(num,2);<br />
}<br />
<br />
function mouseOut(num)<br />
{<br />
swap(num,1);<br />
}<br />
<br />
function mouseDown(num)<br />
{<br />
swap(num,3);<br />
}<br />
<br />
function mouseUp(num)<br />
{<br />
swap(num,2);<br />
}<br />
<br />
</script><br />
<br />
</html><br />
{{:Team:Heidelberg/Pagetop|home}}<br />
<html><br />
<br />
<div id="wrapperheadline">iGEM Heidelberg Mission 2010: miBricks</div><br><br />
<br />
<div id="projectabstract">The great potential of gene therapy is currently limited by two major challenges: tissue specific gene delivery and regulation of gene expression, either dependent on cell-specific properties or intentionally independent of the cellular context. We followed two synergistic tracks to address these problems.<br> <br />
One, we have developed a novel method for miRNA based gene expression tuning in mammalian cells, allowing the fine-tuning of gene expression based on synthetic miRNAs, as well as the cell specific on- and off-targeting based on endogenous miRNAs. We show that this method is functional in vivo and in vitro and prove the high potential of all three miRNA-based regulation approaches.<br> <br />
Two, we have developed a standardized and fast approach towards the creation of AAV-based gene delivery vectors. We have achieved exceptionally selective tissue-specific targeting <i>in vitro</i> and <i>in vivo</i> with hepatocyte specific delivery vectors.<br> <br />
We are happy to provide the synthetic biology community with two high impact innovations which will fuel the improvement of tissue specific gene therapy approaches and other medical applications of synthetic biology.</div><br> <br />
<br />
<div id="slider"><br />
<a href="https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling"><img src="https://static.igem.org/mediawiki/2010/e/ed/Slide_CapShuffling.png" alt="" rel="https://static.igem.org/mediawiki/2010/3/30/Slide_CapShuffling_thumb.png"/></a><br />
<a href="https://2010.igem.org/Team:Heidelberg/Modeling"><img src="https://static.igem.org/mediawiki/2010/f/fc/Bioinfo.png" alt="" rel="https://static.igem.org/mediawiki/2010/0/0d/Bioinfo_thumb.png"/></a><br />
<a href="https://2010.igem.org/Team:Heidelberg/Project/miMeasure"><img src="https://static.igem.org/mediawiki/2010/e/ee/Slide_miMeasure.png" alt="" rel="https://static.igem.org/mediawiki/2010/f/f0/Slide_miMeasure_thumb.png"/></a><br />
<a href="https://2010.igem.org/Team:Heidelberg/Project/miMeasure"><img src="https://static.igem.org/mediawiki/2010/7/72/Slider_in_vivo.png" alt="" rel="https://static.igem.org/mediawiki/2010/a/a3/Slider_in_vivo_thumb.png"/></a><br />
</div><br><br><br><br><br />
<br />
<br />
<br />
<div id="pics"><br />
<a class="piclinks" href="javascript:writeText('And we are not talking about fashion! In our team, a group of students was in charge of the computational interpretation and modeling of the data generated. Want to read more? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Modeling&quot;>here</a>!')" onMouseOver="mouseOver(1)" onMouseOut="mouseOut(1)" onMouseDown="mouseDown(1)" onMouseUp="mouseUp(1)"><br />
<img id="pic1" border=0 src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team comprised a group of twenty motivated students from eight different countries, two instructors and eight advisors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Team&quot;>here</a>!')" onMouseOver="mouseOver(2)" onMouseOut="mouseOut(2)" onMouseDown="mouseDown(2)" onMouseUp="mouseUp(2)"><br />
<img id="pic2" border=0 src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png"; /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('A philosophy and a psychology student helped us to understand how Synthetic Biology interacts with society. Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Human_Practices&quot;>here</a> to see how our science is percieved by the public!')" onMouseOver="mouseOver(3)" onMouseOut="mouseOut(3)" onMouseDown="mouseDown(3)" onMouseUp="mouseUp(3)"><br />
<img id="pic3" border=0 src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png" /><br />
</a><br />
<br />
<center><table id="desc-table"><tr><td><div id ="desc" border=0><center>Please click a Button to get more information! </center></div></td></tr></table></center><br />
<br />
<br />
<a class="piclinks" href="javascript:writeText('As in any piece of research, we have been keeping detailed notebooks with the experiments we have done. Want to retrace our steps? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Notebook&quot;>here</a>!')" onMouseOver="mouseOver(4)" onMouseOut="mouseOut(4)" onMouseDown="mouseDown(4)" onMouseUp="mouseUp(4)"><br />
<img id="pic4" border=0 src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('We have generated more than 100 parts that have been sent to iGEM headquarters. Want to know which ones? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Parts&quot;>here</a>!')" onMouseOver="mouseOver(5)" onMouseOut="mouseOut(5)" onMouseDown="mouseDown(5)" onMouseUp="mouseUp(5)"><br />
<img id="pic5" border=0 src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team was sponsored by a non-profit organization, nine companies and three academic sponsors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Support&quot;>here</a>!')" onMouseOver="mouseOver(6)" onMouseOut="mouseOut(6)" onMouseDown="mouseDown(6)" onMouseUp="mouseUp(6)"><br />
<img id="pic6" border=0 src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png" /><br />
</a><br />
</div><br><br><br />
<div class="clear"></div><br />
</div><br />
<br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<body><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/a/a4/Igemhd2010_2s.png" width=268px/><br><br />
<br />
<object type="application/x-shockwave-flash" data="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&bgcolor=f2f2f2&date_month=11&date_day=05&date_year=0&un=IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" width="250" height="80"><param name="movie" value="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&date_month=11&date_day=05&date_year=0&un=UNTIL IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" /><param name="bgcolor" value="#f2f2f2" /></object><br />
<br />
<h3>The iGEM idea</h3><br />
<br />
iGEM (international Genetically Engineered Machines Competition) is an international competition in synthetic biology, hosted by the MIT in Boston. The aim of this competition is to answer a basic question once posted by the director of iGEM, Randy Rettberg, as follows: "Can simple biological systems be built from standard, interchangeable parts and operated in living cells? Or is biology just too complicated to be engineered in this way?"<br />
<br><br />
International student teams participating in the iGEM compete to answer this fundamental question by engineering biological systems with a proper function. More than 100 interdisciplinary student teams from all over the world, mainly consisting of undergraduate students in biology, biochemistry, engineering, informatics and mathematics, carry out different projects during the Summer to follow this approach. <br />
<br><br />
Projects involved in iGEM reach from medical applications, such as genetically modified bacteria used in cancer-treatment to environmental and manufacturing projects, which allow the construction of a dynamic, watch-like counter consisting of living cells. In contrast to classical genetic engineering where only one gene is transferred from organism A to organism B, synthetic biology advances into the construction of new systems as a whole with totally new emerging properties. Therefore, each iGEM-Teams gets access to a gene-Database called "registry", where hundreds of different genetic parts with characterized functions are available in a “plug-and-play”–like manner. These parts can be simply stuck together to create new functional systems. The rising number of iGEM-Teams over the last years as well as the upcoming public interest in iGEM as well as in the iGEM-Teams’ projects and synthetic biology in general shows that synthetic biology will demonstrate an essential contribution to understand the functional way of life and have an enormous impact on many different fields of both scientific reseach and every-day life.<br />
<br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-28T03:54:37Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
== 02/10/2010 ==<br />
<br /><br />
*digestion in 50 µl of <br />
**4x pSB1C3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
**4x pSB1A3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
<br />
== 05/10/2010 ==<br />
<br /><br />
*1µg digestion of miMeasure and 6 different constructs (1A, 3F, 13, 15, 17, 37) with EcoRI and PstI<br />
<br />
:1= 0S<br />
:2= 0L<br />
:3= 10S<br />
:4= 10L<br />
<br />
<br />
== 06/10/2010 ==<br />
<br />
20 Miniprep:<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: 20 Minis'''<br />
|Number||binding site against miRNA x||Position<br />
|-<br />
|1||221||3.5<br />
|-<br />
|2||221||1.4<br />
|-<br />
|3||1179||3.1<br />
|-<br />
|4||4286||2.6<br />
|-<br />
|5||4286||4.1<br />
|-<br />
|6||4286||3.4<br />
|-<br />
|7||1179||4.4<br />
|-<br />
|8||1179|3.5<br />
|-<br />
|9||1179||1.9<br />
|-<br />
|10||221||4.6<br />
|-<br />
|11||221||1.5<br />
|-<br />
|12||4286||3.5<br />
|-<br />
|13||221||4.8<br />
|-<br />
|14||221||2.3<br />
|-<br />
|15||4286||2.2<br />
|-<br />
|16||4286||1.3<br />
|-<br />
|17||1179||2.5<br />
|-<br />
|18||1179||2.4<br />
|-<br />
|19||1179||1.5<br />
|-<br />
|20||1179||4.8<br />
|}<br />
<br />
* digestion of miMeasure and 6 different synthetic miRNA patterns against endogenous miR122<br />
* gel seperation<br />
* gel purification<br />
* sequencing<br />
----<br />
<br />
<br />
== 12/10/2010 ==<br />
<br />
4 miraPCRs for binding sites of miR4286.<br />
* one PCR with an annealing temperature of 45 degree and 16 cycles<br />
* second miraPCR with annealing temperature of 57 degree and also 16 cycles<br />
**nucleotide removal<br />
**digestion<br />
**gel seperation<br />
**gel purification<br />
**ligation in miMeasure and pSB1C3 <br />
**transformation<br />
<br />
== 13/10/2010 ==<br />
<br />
*pick colonies<br />
*about 8 hours later: do minipreps<br />
*send for sequencing<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
----<br />
<br />
= 14/10/2010 =<br />
* a reasonable<br />
* Screening of 40 colonies of miR4286 (colony PCR)<br />
* Screening of 32 colonies of miR320b (colony PCR)<br />
<br />
<br />
all negative<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 15/10/2010 =<br />
<br />
ligation of miMeasure construct:<br /><br /><br />
<br />
miR-122<br /><br />
miR-122ran<br /><br />
miR-1179<br /><br />
miR-221<br /><br />
<br /><br />
each in 0S/0L/10S/10L versions<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
= 16/10/2010 =<br />
transformation of each ligation to TOP10 ''E.coli''<br />
<br />
cells were plated on LB-amp plates <br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 17/10/2010 =<br />
<br />
96 colony PCRs - 8 from each plate<br />
<br><br />
ALL NEGATIVE!!!!<br />
<br /><br /><br /><br />
<br />
----</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-28T03:54:17Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
== 02/10/2010 ==<br />
<br /><br />
*digestion in 50 µl of <br />
**4x pSB1C3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
**4x pSB1A3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
<br />
== 05/10/2010 ==<br />
<br /><br />
*1µg digestion of miMeasure and 6 different constructs (1A, 3F, 13, 15, 17, 37) with EcoRI and PstI<br />
<br />
:1= 0S<br />
:2= 0L<br />
:3= 10S<br />
:4= 10L<br />
<br />
<br />
== 06/10/2010 ==<br />
<br />
20 Miniprep:<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: 20 Minis'''<br />
|Number||binding site against miRNA x||Position<br />
|-<br />
|1||221||3.5<br />
|-<br />
|2||221||1.4<br />
|-<br />
|3||1179||3.1<br />
|-<br />
|4||4286||2.6<br />
|-<br />
|5||4286||4.1<br />
|-<br />
|6||4286||3.4<br />
|-<br />
|7||1179||4.4<br />
|-<br />
|8||1179|3.5<br />
|-<br />
|9||1179||1.9<br />
|-<br />
|10||221||4.6<br />
|-<br />
|11||221||1.5<br />
|-<br />
|12||4286||3.5<br />
|-<br />
|13||221||4.8<br />
|-<br />
|14||221||2.3<br />
|-<br />
|15||4286||2.2<br />
|-<br />
|16||4286||1.3<br />
|-<br />
|17||1179||2.5<br />
|-<br />
|18||1179||2.4<br />
|-<br />
|19||1179||1.5<br />
|-<br />
|20||1179||4.8<br />
|}<br />
<br />
* digestion of miMeasure and 6 different synthetic miRNA patterns against endogenous miR122<br />
* gel seperation<br />
* gel purification<br />
* sequencing<br />
----<br />
<br />
<br />
== 12/10/2010 ==<br />
<br />
4 miraPCRs for binding sites of miR4286.<br />
* one PCR with an annealing temperature of 45 degree and 16 cycles<br />
* second miraPCR with annealing temperature of 57 degree and also 16 cycles<br />
**nucleotide removal<br />
**digestion<br />
**gel seperation<br />
**gel purification<br />
**ligation in miMeasure and pSB1C3 <br />
**transformation<br />
<br />
== 13/10/2010 ==<br />
<br />
*pick colonies<br />
*about 8 hours later: do minipreps<br />
*send for sequencing<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
----<br />
<br />
= 14/10/2010 =<br />
* a reasonable<br />
* Screening of 40 colonies of miR4286 (colony PCR)<br />
* Screening of 32 colonies of miR320b (colony PCR)<br />
<br />
<br />
all negative<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 15/10/2010 =<br />
<br />
ligation of miMeasure construct:<br /><br /><br />
<br />
miR-122<br /><br />
miR-122ran<br /><br />
miR-1179<br /><br />
miR-221<br /><br />
<br /><br />
each in 0S/0L/10S/10L versions<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
= 16/10/2010 =<br />
transformation of each ligation to TOP10 ''E.coli''<br />
<br />
cells were plated on LB-amp plates <br />
<br /><br /><br /><br />
<br />
----<br />
<br />
= 17/10/2010 =<br />
<br />
96 colony PCRs - 8 from each plate<br />
<br><br />
ALL NEGATIVE!!!!<br />
<br /><br /><br /><br />
<br />
----</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:44:48Z<p>Kleinsorg: /* 25/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
*miR122 samples were ligated into psiCHECK2-plasmid <br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase.<br />
<br />
Afterwards they were transformed into TOP10 E. coli and grown over night in LB-Ampicillin-medium<br />
<br />
<br><br><br />
----<br />
<br />
== 22/09/2010 ==<br />
<br />
Plasmid DNA was extracted from over night cultures using Qiagen Plasmid Miniprep Kit.<br />
<br />
DNA was then analysed via test-digestion with NotI/XhoI Enzymes.<br />
<br />
Test digestion was performed in 20 µL using 0.4µL Enzyme, supplied with NEB buffer 3 and BSA for 1h @ 37°C.<br />
<br />
Test digestion was then analysed on a 2% agarose gel.<br />
<br />
No sample showed any insert....<br />
<br />
<br><br><br />
----<br />
<br />
== 23/09/2010 ==<br />
<br />
strategy change -> psiCHECK2-plasmid is somehow not working<br />
<br />
from now on, all samples will be cloned into the standard plasmid PSB1C3-P1010.<br />
<br />
When all constructs are in there, they could be cloned into their destination (miMeasure) vector using standard-cloning strategy.<br />
<br />
Undigsted raPCR outcome of miR122 was amplified using [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR ra017] and [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR ra018].<br />
<br />
The PCR was then gel extracted using Qiagen Gel extraction protocol according to the 0S/0L/10S/10L scheme.<br />
<br><br><br />
<br />
----<br />
<br />
== 24/09/2010 ==<br />
<br />
Digestion of the PCR from 23/09/2010 with EcoRI and PstI in NEB EcoRI Buffer + BSA @37°C for 4h. The digestion was then purified using Qiagen PCR purification protocol.<br />
<br />
Sample concentrations were determined. Molar ratio: backbone - inser -> 1:5<br />
<br />
Ligation was set up over night at 25°C using Fermentas T4 ligase according to procol<br />
<br />
<br><br><br />
----<br />
<br />
== 25/09/2010 ==<br />
<br />
Transformation of miR-122 ligation to TOP10 E.coli. Cells were plated on LB-chloramphenicol-plates.<br />
<br><br><br />
<br />
----<br />
<br />
== 26/09/2010 ==<br />
<br />
Colony PCR using [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer BBB-standard primer] was performed to screen for positive clones.<br />
<br />
Over night culture of transformation from 25/09/2010 was set up (5mL LB-chloramphenicol-medium) for clones which could be positive: <br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
*1.3, 1.5, 1.7, 3.8, 3.2<br />
<br />
----<br />
<br />
== 27/09/2010 ==<br />
<br />
Plasmid preparation from over night culture using Qiagen Plasmid Minipreparation Kit. Samples were eluted in a total volume of 50µL water.<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:44:13Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
*miR122 samples were ligated into psiCHECK2-plasmid <br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase.<br />
<br />
Afterwards they were transformed into TOP10 E. coli and grown over night in LB-Ampicillin-medium<br />
<br />
<br><br><br />
----<br />
<br />
== 22/09/2010 ==<br />
<br />
Plasmid DNA was extracted from over night cultures using Qiagen Plasmid Miniprep Kit.<br />
<br />
DNA was then analysed via test-digestion with NotI/XhoI Enzymes.<br />
<br />
Test digestion was performed in 20 µL using 0.4µL Enzyme, supplied with NEB buffer 3 and BSA for 1h @ 37°C.<br />
<br />
Test digestion was then analysed on a 2% agarose gel.<br />
<br />
No sample showed any insert....<br />
<br />
<br><br><br />
----<br />
<br />
== 23/09/2010 ==<br />
<br />
strategy change -> psiCHECK2-plasmid is somehow not working<br />
<br />
from now on, all samples will be cloned into the standard plasmid PSB1C3-P1010.<br />
<br />
When all constructs are in there, they could be cloned into their destination (miMeasure) vector using standard-cloning strategy.<br />
<br />
Undigsted raPCR outcome of miR122 was amplified using [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR ra017] and [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR ra018].<br />
<br />
The PCR was then gel extracted using Qiagen Gel extraction protocol according to the 0S/0L/10S/10L scheme.<br />
<br><br><br />
<br />
----<br />
<br />
== 24/09/2010 ==<br />
<br />
Digestion of the PCR from 23/09/2010 with EcoRI and PstI in NEB EcoRI Buffer + BSA @37°C for 4h. The digestion was then purified using Qiagen PCR purification protocol.<br />
<br />
Sample concentrations were determined. Molar ratio: backbone - inser -> 1:5<br />
<br />
Ligation was set up over night at 25°C using Fermentas T4 ligase according to procol<br />
<br />
<br><br><br />
----<br />
<br />
== 25/09/2010 ==<br />
<br />
Transformation of miR-122 ligation to TOP10 E.coli. Cells were plated on LB-chloramphenicol-plates.<br />
<br />
----<br />
<br />
== 26/09/2010 ==<br />
<br />
Colony PCR using [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer BBB-standard primer] was performed to screen for positive clones.<br />
<br />
Over night culture of transformation from 25/09/2010 was set up (5mL LB-chloramphenicol-medium) for clones which could be positive: <br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
*1.3, 1.5, 1.7, 3.8, 3.2<br />
<br />
----<br />
<br />
== 27/09/2010 ==<br />
<br />
Plasmid preparation from over night culture using Qiagen Plasmid Minipreparation Kit. Samples were eluted in a total volume of 50µL water.<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:28:53Z<p>Kleinsorg: /* 21/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
*miR122 samples were ligated into psiCHECK2-plasmid <br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase.<br />
<br />
Afterwards they were transformed into TOP10 E. coli and grown over night in LB-Ampicillin-medium<br />
<br />
<br><br><br />
----<br />
<br />
== 22/09/2010 ==<br />
<br />
Plasmid DNA was extracted from over night cultures using Qiagen Plasmid Miniprep Kit.<br />
<br />
DNA was then analysed via test-digestion with NotI/XhoI Enzymes.<br />
<br />
Test digestion was performed in 20 µL using 0.4µL Enzyme, supplied with NEB buffer 3 and BSA for 1h @ 37°C.<br />
<br />
Test digestion was then analysed on a 2% agarose gel.<br />
<br />
No sample showed any insert....<br />
<br />
<br><br><br />
----<br />
<br />
== 23/09/2010 ==<br />
<br />
strategy change -> psiCHECK2-plasmid is somehow not working<br />
<br />
from now on, all samples will be cloned into the standard plasmid PSB1C3-P1010.<br />
<br />
When all constructs are in there, they could be cloned into their destination (miMeasure) vector using standard-cloning strategy.<br />
<br />
----<br />
<br />
== 24/09/2010 ==<br />
<br />
<br><br><br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:25:01Z<p>Kleinsorg: /* 21/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
*miR122 samples were ligated into psiCHECK2-plasmid <br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase.<br />
<br />
Afterwards they were transformed into TOP10 E. coli and grown over night in LB-Ampicillin-medium<br />
<br />
<br><br><br />
----<br />
<br />
== 22/09/2010 ==<br />
<br />
Plasmid DNA was extracted from over night cultures using Qiagen Plasmid Miniprep Kit.<br />
<br />
DNA was then analysed via test-digestion with NotI/XhoI Enzymes.<br />
<br />
Test digestion was performed in 20 µL using 0.4µL Enzyme, supplied with NEB buffer 3 and BSA for 1h @ 37°C.<br />
<br />
Test digestion was then analysed on a 2% agarose gel.<br />
<br />
No sample showed any insert....<br />
<br />
<br><br><br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:17:57Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/AugustTeam:Heidelberg/Notebook/BSDesign/August2010-10-28T03:17:53Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design - August=<br />
<br />
<br />
== 01/08/2010 ==<br />
[[Image:Ragel1_0801.png|thumb|250px|right|Gel1: diraPCR product analyzed on 1 % agarose gel (see gel1). The second, 25 cycle PCR was performed with different amounts of 12 cycle PCR product, resulting in different product ranges]]<br />
<br /><br />
* diraPCR product from previous day was PCR purified by applying the Qiagen PCR purification Kit (elution in 32 ul nuclease-free water)<br />
* in parallel, 5 ul of PCR product were analyzed on a 1 % agarose gel; interestingly, the diraPCR product range can obviously be controlled by applying different amount on 12 cycle PCR product in the 25 cycle PCR. When 5 ul, 10 ul or 20 ul of 12 cycle PCR product were applied in the second PCR, the resulting product ranges where in between 100-400, 300-700 and 500-2000 respectively. When 2 ul or a lower amount of 12 cycle PCR product was applied, the product the subsequent 25 cycles was hardly visible. <br />
<br /><br />
* PCR-purified product was digested with EcoRI and PstI and run on a preperative 1 % agarose gel (100 V/ 1 h) (see gel2). <br />
* The 200, 400 and 700 bp band of the lanes, appearing brightes under the UV light, were cut out of the gel and gel purified applying the Qiagen gel purification kit<br />
<br /><br />
* a single colony from the pSB1A3 transformation (previous day) was picked and used for inocculating two 5 ml cultures (LB-Amp)<br />
* cultures were incubated for 8 h at 37 °C<br />
* subsequently, 200 ul of the first culture were used for inocculating a 200 ml overnight culture for maxiprep (LB-Amp)<br />
* 4 ml of the second culture were pelleted and used for MiniPrep (Qiagen); elution in 40 ul nuclease free water<br />
* 31 ul of the Miniprep product were digested with EcoRI and PstI and loaded on an preperative agarose gel; as control, 5 ul of undigested vector and 10 ul of each the digestion product of the 200, 400 and 700 bp bands (see above) were loaded as well (see gel3). The linearized vector has two additional bands at around 1.3 and 3.5 kb, which were not expected. Explanations could be the formation of dimers or even the contamination of the registry-well with a different construct.<br />
<br />
<br />[[Image:PSB1A3_raPCR_digest.png|thumb|400px|left|Gel3: 200, 400 and 1000 bp band show only weak product bands. The uncut vector has, as expected, a size of ~2.1 kb; however, after cutting, a 1.3 kb and a 3.5 kb appear in addition to the expected 2.1 kb band of linearized vector.]]<br />
[[Image:Ragel2_0801.png|thumb|350px|right|Gel2: the 200, 400 and 700 bp band of the brightest lanes were cut out]]<br />
<br /><br />
<br /><br />
<br />
<br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br />
<br />
== 02/08/2010 ==<br />
<br /><br />
* transformation of the cloning that has been done on the previous day (raPCR hsa-mir-886_3p binding site pattern)<br />
* maxiprep of pSB1A3 (culture was inocculated on the previous day); elution was done with 1 ml water (miliQ, autoclaved)<br />
* digestion of 2 times 2 ug of pSB1A3 maxiprep DNA with EcoRI and PstI overnight at 4 °C<br />
<br /><br />
* picking 20 colonies from the tranformed plates (tranformation on this day); 5 colonies of each the 200 and 400 bp band construct, 10 colonies of the 1000 bp construct for:<br />
:a) colony PCR (24 ul of water, 0.5 ul of each standards sequencing primer VF and VR, 25 ul of mastermix and bakterial colony)<br />
:b) inocculation of overnight miniprep LB cultures with the same, picked colonies<br />
<br /><br />
<br /><br />
<br />
----<br />
<br />
== 03/08/2010 ==<br />
[[Image:ColonyPCR_0805.png|thumb|450 px|Colony PCR; the length of the cloned binding site patterns is indicated (200, 400 or 1000 bp) as well as the number of the clone that was picked; K: negative control]]<br />
[[Image:ColonyPCR_0805_B.png|thumb|450px|Colony PCR; the length of the cloned binding site patterns is indicated (200, 400 or 1000 bp) as well as the number of the clone that was picked; K: negative control]]<br />
<br />
* loading colony PCR samples from the previous day on 1 % analytic agarose gel; sample 6 (400 bp) seems positive<br />
<br />
<br />
<br />
diraPCR for constructing hsa-886-3p binding site patterns<br />
<br />
the diraPCR was pipetted according to the following protocol in three repeats: <br />
<br />
*1 ul of each binding site oligo<br />
*0.5 ul of each stop oligo<br />
*25 ul of Phusion MasterMix<br />
*add water to final volume of 50 ul <br />
<br />
<br />
each of the three 12 cycle PCR repeats were performed according to the standard miRACLE PCR protocol<br />
<br />
the three 12x repeats (1,2,3) were each split into two (1A, 1B, 2A, 2B, 3A, 3B) and the 25 cycle PCR was performed according to the standard miRACLE PCR protocol<br />
<br />
after PCR purification the subsequent PCR reaction was pipetted as follows: <br />
<br />
*10 of 12 cycle PCR product<br />
*0.5 ul of each stop oligo<br />
*25 ul of Phusion MasterMix<br />
*add water to final volume of 50 ul<br />
[[Image:raPCR_0410.png|thumb|450px|right|Gel: the 200, 400 and 1000 bp band of the brightest lanes were cut out]]<br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br /><br />
<br />
----<br />
<br />
== 04/08/2010 ==<br />
<br />
* Samples from the 12cycle and 25cycle PCR were resolved on the 1% agarose gel. <br />
<br />
12cycle PCR: 1ul of 5x loading dye + 2.5ul of purified DNA<br />
<br />
25cycle PCR: 1ul of 5x loading dye + 5ul of PCR mixture<br />
<br />
gel map:<br />
1kbLadder - 12x(1)- 12x(2)- 12x(3)- DNAladderMix - 1A - 1B - 2A - 2B - 3A - 3B<br />
<br /><br />
* Miniprep of the positive clone (400 bp, nr.6 ) from the previous day; sample is send for sequencing with standard primers VF2 and VR --> result is negative<br />
<br /><br />
<br />
----<br />
<br />
== 05/08/2010 ==<br />
[[Image:PSB1A3_digest.png|thumb|300 px|Digestion of the positive clone (previous day) and preperative digestion of vector pSB1A3; Ctr: Test Digestion of Vector pSB1A3, dig: Digestion of positive, no insert is dropping out (negative); 2.1 kb vector band was cut out, but unexpected ~1.2 kb band occured again. Therefor the vector was wasted]]<br />
<br /><br />
* digestion of pSB1A3 with EcoRI and PstI according to the following protocol (6 repititions):<br />
:* 6 ul (2 ug) of pSB1A3<br />
:* 3 ul of NEB Buffer EcoRI<br />
:* 3 ul of 10x BSA<br />
:* 0.5 ul of each enzyme<br />
:* 17 ul of nuclease-free water<br />
Digestion is performed o/n @ 4 °C<br />
<br /><br />
* repitition of colony-PCR with the cloned constructs from the 02/2010; 6 colonies (of each the 200, 400 and 1000 bp cloning plate) and a negative control were picked. A colony PCR was performed according to the protocol described on the 03/2010 and miniprep cultures were inocculated.<br />
* Inocculation of 200 ml maxiprep LB cultures of the plasmids pSi Fluor 2, pSi Fluor 2(star) and pSi RcSRRE<br />
<br /><br /><br /><br /><br /><br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 06/08/2010 ==<br />
<br /><br />
* Maxiprep of the cultures inocculated the previous day was performed according to the Qiagen Maxiprep Protocol. Afterwards, DNA concentration and purity was measured using the nanodrop:<br />
<br />
:*pSiRcSRRE - 468.5ng/ul (260/280 - 1.870)<br />
:*pSiFluor2 - 274ng/ul (260/280 - 1.870)<br />
:*pSiFluor2* - 225ng/ul (260/280 - 2.885)<br />
<br /><br />
<br /><br />
<br />
----<br />
<br />
== 07/08/2010 ==<br />
<br /><br />
* second strand synthesis PCR: for the microRNAs hsa-miR-886-3p, hsa-miR-769-5p, hsa-miR-299-3p, hsa-miR-365, hsa-miR-886-5p, hsa-miR-548a-5p, hsa-miR-487a, hsa-miR-122 we constructed two oligos each. One oligo contained a perfectly matching binding site for the corresponding miRNA, the second one had randomized oligos introduced at positions 9-12. Second strand synthesis was performed according to the protocol described [[here (Link)]]. The PCR product was purified by applying the Qiagen Nucleotide Removal Kit (elution in 37 ul water). 3 ul of the purified PCR product was then analyzed on an 2 % agarose gel, run for 65 min @ 135 V (Gel 1 and 2).<br />
[[Image:0808_sbs1.png|thumb|left|400px|l|Gel 1: Purified PCR product for single binding site and single binding site library design. The band at ~45 bp corresponds to the expected binding site length; microRNAs are indicated, as well as perfect (p) and 9-12 mutated (m) single binding sites]]<br />
[[Image:0808_sbs2.png|thumb|400px|center|Gel 2: Purified PCR product for single binding site and single binding site library design. The band at ~45 bp corresponds to the expected binding site length; microRNAs are indicated, as well as perfect (p) and 9-12 mutated (m) single binding sites]]<br />
<br /><br />
* Digestion of pSB1A3, pSB1T3 and pSB1C3 (linearized ready-to-use version from 2010 spring distribution, 750 ng each) with EcoRI and PstI according to the following protocol:<br />
:* 15 ul vector, 24 ul water, 5 ul BSA, 5 ul NEB Buffer EcoRI, 0.5 ul of each EcoRI and PstI; incubation for 1 h @ 37 °C<br />
:* heat inactivation for 20 min @ 80 °C<br />
:* adding of 0.5 ul SAP (shrimp acidic phosphatase) and DpnI<br />
:* incubation for 1 h @ 37 °C<br />
<br /><br />
* Digestion of pSB1A3 (Maxiprep) with EcoRI and PstI according to the following protocol:<br />
:* 3 ul (1 ug) vector, 36 ul water, 5 ul BSA, 5 ul NEB Buffer EcoRI, 0.5 ul of each EcoRI and PstI; incubation for 1 h @ 37 °C<br />
:* heat inactivation for 20 min @ 80 °C<br />
*: adding of 0.5 ul SAP, incubation for 1 h @ 37 °C<br />
<br /><br />
* Digestion of purified PCR product for the single bindig sites according to the following protocol:<br />
:* 30 ul DNA, 9 ul water, 5 ul BSA, 5 ul NEB Buffer EcoRI, 0.5 ul of each EcoRI and PstI; incubation for 1 h @ 37 °C<br />
:* purification of DNA by applying a Qiagen Nucleotide Removal Kit (elution in 37 ul water)<br />
<br /><br />
* The digestion procuts were analyzed on a 2 % agarose gel, run for 35 min @ 135 V (gel 3 and 4)<br />
[[Image:0809_sbs1.png|thumb|350 px|left|Gel 3: digested ready-to-use plasmids (EcoRI and PstI cut) and single binding site digestion products; microRNAs are indicated, as well as perfect (p) and 9-12 mutated (m) single binding sites]]<br />
[[Image:0809_sbs2.png|thumb|350 px|center|Gel 4: single binding site digestion products cut EcoRI and PstI; microRNAs are indicated, as well as perfect (p) and 9-12 mutated (m) single binding sites]]<br />
<br /><br />
<br /><br />
<br />
----<br />
<br />
== 08/08/2010 ==<br />
[[Image:0809_3.png|thumb|300px|right|Analysis of purified vector and 200, 400 & 1000 bp insert; vector band is clearly visible as well as a faint band for the 200 and 400 bp BSP. For the other samples, the DNA concentration is too low for analysis on an agarose gel]]<br />
<br /><br />
* digestion of mir-886-5p binding site patterns (purified PCR product) madu on the 05/2010 according to the following protocol:<br />
:* 200 bp band: 20 ul of vector, 5 ul of BSA, 5 ul of NEB Buffer EcoRI<br />
* purification of single binding site and vector digestion products (previous day) on a 2 % agarose gel (run for 35 min @ 100 V).<br />
* Ligation of single bindig sites and binding site pattern into pSB1A3 was performed according to the following protocols:<br />
:*single binding sites (16 and 17): 6 ul of pSB1A3 (~60 ng) vector, 1 ul of single binding site insert, 10 ul water, 2 ul ligase buffer, 1 ul T4 ligase<br />
:*200 bp binding site pattern: 6 ul of pSB1A3, 4 ul of Insert (~ 30 ng), 2 ul of ligase buffer, 1 ul ligase, 7 ul water<br />
:*400 bp binding site pattern: 6 ul of pSB1A3, 5 ul of Insert (~40 ng), 2 ul of ligase buffer, 1 ul of ligase, 6 ul of watetr<br />
:*control: 6 ul pSB1A3, 2 ul ligase buffer, 1 ul ligase, 11 ul water<br />
<br /><br />
Ligation reaction was incubated at 19 °C for 5 h; 10 ul of each ligation reaction was transformed into E. coli Top10 according to the standard transformation protocol.<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
== 09/08/2010 ==<br />
<br /><br />
* transformation of pSB1C3 standard assebly vector from the registry (according to the resitry standard protocl)<br />
<br /><br />
* Picking of Colonies from the privious days' cloning for inocculating miniprep LB cultures and for performing colony PCR; The colony-PCR was performed according to the following protocol:<br />
<br /><br />
for single binding sites: <br />
:*25 ul MasterMix<br />
:* 24 ul water<br />
:* 0.5 ul of each primer (VF2 and SBSSSS_PstI)<br />
:* colony picked<br />
<br /><br />
for binding site patterns:<br />
:*25 ul MasterMix<br />
:* 24 ul water<br />
:* 0.5 ul of each primer (miRaPCR_Stop_fw(EcoRI) and miRaPCR_Stop_rev(PstI))<br />
:* colony picked<br />
<br /><br />
PCR was performed according to the standard colony PCR protocol<br />
<br /><br />
<br /><br />
<br />
----<br />
<br />
== 10/08/2010 ==<br />
<br /><br />
[[Image:20100810_1.png|thumb|450px|right| Colony PCR of single binding site cloning and binding site pattern cloning analyzed on a 1.5 % agarose gel. 9 of 10 single binding site colonies (2-10) show the right band. The binding site pattern doen't show a any band at all, possibly due to primer dimers.]]<br />
<br />
* The colony-PCR from the previous day (for single binding site and binding site pattern cloning) was analyzed on a 1.5 % agarose gel. For single binding site, 90 % of the colonies were positive, showing the right band at ~ 170 bp. The negative control was also negative, indicating the PCR worked fine wihtout any contamination. For the binding site patterns, all samples were negative, not showing any band 300 bp upwards. It is assumed, that this might be due to the fact, that the raPCR primes can form strong dimers, making the delicate colony PCR not work properly.<br />
<br /><br />
* Digest of pSi plasmid was done sequntially and also simultaneously. <br />
:*Simultaneous reaction:<br />
:*Nhe1 and Not1 added together in NEB2 buffer (Nhe1 activity - 100%; Not1 activity 50%)for 2.5 hours @37°C;inactivation at 65°C for 20min. The mixture was then treated with SAP for 1hr and stored on ice overnight<br />
:*Sequential reaction:<br />
:*Nhe1 andded in NEB2 buffer (100%activity expected) for 2.5hrs @37°C; inactivation @65°C for 20min and stored on ice overnight<br />
<br /><br />
*Gel analysis on 0.8%agarose:<br />
:*Ladder mixes were tested on the same gel. Lane 1 contained ''DNA Ladder Mix'',lane 5 contained ''DNA Ladder High Range'' and lane 9 contained ''1kb DNA Ladder Plus'' which proved to be most effective for this setup.<br />
:*Lanes 2,3 and 4 contained products of sequential reaction<br />
:*Lanes 6,7 and 8 contained products of simultaneous reaction<br />
<br />
*Gel extraction protocol was followed for lines ~5.5kb (final volume 30ul in water) and NanoDrop analysis showed following results:<br />
:*Sequential: 5.9ng/ul<br />
:*Simultaneous: 9.6ng/ul<br />
<br />
[[Image:10082010A.png|thumb|400px|left| Digestion products of pSi plasmid after 45min at 100V on 0.8%agarose. Lanes 1,5 and 9 used for testing the DNA ladders. Lanes 2,3 and 4 are from sequential digest by Nhe1. Lanes 6,7 and 8 are from simultaneous digest by Nhe1 and Not1]]<br />
<br />
[[Image:10082010B.png|thumb|320px|center| The same gel after 45+90mins]]<br />
<br /><br /><br /><br />
<br />
----<br />
<br />
== 11/08/2010 ==<br />
<br /><br />
* Picking of 5 additional colonies of the transformation (binding site patterns) from the plates containing the 200 bp and 400 bp constructs from 09/2010; Performing standard colony PCR using the standard sequenzing primers VF2 and VR. Negative colonies (not containing any binding site pattern, but just religated vector) should show a band at ~290 bp. In parallel, miniprep LB cultures were inocculated using the same, picked colonies.<br />
* although the bands seem too short, the colonies nr. 4, 5 (!), 8 and 10 of the 400 bp band seem positive (gel picture). Minipreps were performed applying the Qiagen Miniprep Kit and were sen for overnight sequenzing (@ GATC).<br />
[[Image:20100811_1.png|thumb|450px|center|Result of the colony PCR. The 400 bp binding site pattern samples nr. 4, 5, 8 and 10 were positive and send for sequencing]]<br />
<br />
[[Image:20100811_2.png|thumb|450px|center|Result of colony PCR. The 400 bp colony-PCRs (nr. 1-10) were loaded on a gel again for further specification of the band length]]<br />
<br /><br /><br /><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/JulyTeam:Heidelberg/Notebook/BSDesign/July2010-10-28T03:17:46Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design - July=<br />
<br />
== 05/07/2010 - 11/07/2010 == <br />
<br /><br />
=== Preperation of chemically competent cells E. coli Top10 and DH5alpha ===<br />
* plating of E. coli Top10 and DH5alpha on a agar plate (LB, without Amp); Preperation of competent cells according to the following protocol:<br />
First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl2. After addition of further 190 ml 100 mM CaCl2 the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl2 with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.<br />
<br /><br />
<br />
=== Cell Culture Starting ===<br />
* thawing of Huh-7, HeLa p4 and HEK-293 cells according to the following protocol<br />
:* vials from liquid nitrogen were thawn at 37 °C<br />
:* once, the probe was nearly completely thawn, cells were thrown into pre-warmed DMEM (10 % FCS, L-Glut, P/S) and gentely mixed<br />
:* cells were spinned down at 800 rpm, 3 min; supernatant was discarded<br />
:* the pellet was resuspended in 10 ml DMEM an plated on a p100 cell culture dish in the following media according to the different cell lines:<br />
<br /><br />
Media for Hela and Hek cells:<br />
:* DMEM with 10 % FCS, 1 % L-Glut and 1 % P/S<br />
Media for HUH-7 cells:<br />
:* DMEM with 10 % FCS, 1 % L-Glut and 1 % P/S and 1 % non-essential amino acids<br />
<br /><br />
'''from now on, cells were kept constantly in culture during the whole iGEM'''<br />
for passaging cells, the cells were split according to the following protocol:<br />
:* remove media<br />
:* wash cells one time in PBS (10 ml for p100 dish)<br />
:* remove PBS; add 1-3 ml of trypsin-EDTA solution and incubate cells for 5 min at 37 °C <br />
:* add 5 ml of the according media<br />
:* take 1/10th of the cell suspension and plate out on the according dish (either p100 dish, 6 well plate or T-flask)<br />
<br /><br />
<br /><br />
----<br />
<br />
== 12/07/2010 - 19/07/2010 == <br />
<br /><br />
=== Preperation of RNA extracts for miRNA profiling ===<br />
<br /><br />
*Hela, Hek and HUH were plated on p100 dishes in their according media (10E6 cells/dish) and grown to 60-70 % confluence<br />
*Infection of Hela p4, HUH-7 and HEK cells with AAV serotype 2 (GFP) and incubation for 48 h<br />
*afterwards, RNA Extraction was performed according to the following protocol:<br />
'''Protocol'''<br />
*Samples were afterwards analyzed for miRNA expression by using the FEBIT miRNA profiling service<br />
<br /><br />
*pSB1AC3 from the registry was transformed into Top10 cells according to the standard transformation protocol; a day later, a 5 ml LB culture was inocculated and incubated for 8 hours; plasmid was extracted by applying the Qiagen MiniPrep Protocol<br />
<br /><br />
=== design of diraPCR oligos ===<br />
<br /><br />
* a diraPCR Designer tool (called miRACLE Designer) was programmed for enabling quick&easy design of diraPCR oligos. The program takes any microRNA guiding strand sequence of choice and constructs synthetic microRNA binding site oligos. Those oligos have the following properties:<br />
:* they have a 5' and 3' anealing sequence which is inerte (has no natural microRNA target)<br />
:* the microRNA binding site of choice with randomized nucleotides at position 9-12 and a missmatch introduced at position 0<br />
:* an inerte spacer sequence of 0, 5 10 or 15 bp length<br />
<br /><br />
The miRACLE Designer constructs a set of 8 ready-to-order oligos and prints them out in the common FASTA format. When performing diraPCR, binding sites will be concatomerized with spacer sequences in between 15 and 30 bp length.<br />
<br /><br />
<br />
=== design of measurement standard ===<br />
<br /><br />
* in order to design an appropriety standard respecting all the rules according to the standard of mammalian synthetic biology (RFC12), we developed a dual reporter measurement construct with the following properties:<br />
:* bidirectional CMV promoter driving both reporter genes<br />
:* distabilized EGFP and EBFP2 as reporter genes, as they are really similar in their whole structure and amino-acid sequence<br />
:* BBB prefix and suffix cloned behind the EGFP for easy swapping of binding site patterns<br />
:* unique BamHI and HindIII binding sites introduced behind the EBFP2 reporter for introducing a reference binding site<br />
:* strong SV40 terminators behind both reporters<br />
:* vector backbone, containing an Amp resistance, Hygromycin resistance, pBR322 origin and an FRT site for stable integration<br />
please, find more information about the measurement standard design in the measurment standard page<br />
<br />
<br /><br /><br />
----<br />
<br />
== '''20/07/2010''' ==<br />
<br /><br />
''' Dilution of raPCR-Oligos '''<br />
<br /><br />
* oligos (hsa_miR_886_3p_sp0...) and stop oligo (miRaPCR_Stop_fw_Ecori and miRA_PCR_Stop_rev) diluted to a concentration of 100 um<br />
* Set up raPCR-reactions with different amounts of oligos being pooled<br />
::*2 ul of each hsa_miR_886_3p oligo<br />
::*1.0, 2 or 4 ul of each stop oligo<br />
::*25 ul of Phusion PCR MasterMix<br />
::*add water to a total volume of 50 ul<br />
<br /><br />
''' Seven-Cyle PCR '''<br />
*run seven-cycle PCR under the following conditions<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::55 °C/ 45 sec<br />
::72 °C/ 30 sec<br />
................................................ (7x)<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
* PCR purification of the PCR-product (elution in 42 ul of water)<br />
<br /><br />
''' 25-cycle PCR '''<br />
[[Image:MiR-886-3p_optimization.png|thumb|400px|right]]<br />
* run construct amplification PCR according to the following protocol<br />
<br /><br />
::*20 ul of purified PCR product <br />
::*1 ul of each stop oligo<br />
::*3 ul of water<br />
::*25 ul of Phusion PCR MasterMix<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::65 °C/ 45 sec<br />
::72 °C/ 30 sec<br />
................................................ (25x)<br />
::72 °C/ 5 min<br />
................................................<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
''' Gel Electrophoresis '''<br />
* PCR products from the 25 cycle PCR were analyzed on a Gel. Therefor, 5 ul of PCR product were mixed with 1 ul of 6x-loading dye and loaded on a 1.5 % agarose gel. The gel ran at 135 V for 55 min.<br />
<br /><br /><br />
----<br />
<br />
== ''' 21/07/2010 ''' ==<br />
<br />
* optimization of cycle number and oligo concentration for raPCR<br />
<br /><br />
::*0.5 (BS0.5), 1 (BS1) or 1.5 (BS1.5) ul of each binding site oligo<br />
::*0 (Stop0), 0.5 (stop0.5) or 1 (stop1) ul of each stop oligo<br />
::*25 ul of Phusion PCR MasterMix<br />
::*add water to total volume of 25 ul<br />
<br /><br />
''' 12-cycle PCR '''<br />
* run 12-cycle PCR according to the following program<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::57 °C/ 45 sec<br />
::72 °C/ 45 sec<br />
................................................ (12x)<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
* add 1 ul of each stop oligo to reactions "Stop0"<br />
* run 3-cycle PCR with the "Stop0" reaction according to the following protocol<br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::65 °C/ 45 sec<br />
::72 °C/ 45 sec<br />
................................................ (3x)<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
*PCR purify all products<br />
<br /><br />
'''25-cycle PCR'''<br />
[[Image:MiR-886-3p_longer_fragments.png|thumb|400px|right]] <br />
[[Image:MiR-886-3p_longer_fragments2.png|thumb|400px|right]]<br />
* run 25-cycle PCR in order to amplify constructs<br />
<br /><br />
::*20 ul of purified PCR product <br />
::*1 ul of each stop oligo<br />
::*3 ul of water<br />
::*25 ul of Phusion PCR MasterMix<br />
<br /><br />
::*for construct Stop0.5/BS1 set up an addition reaction as follows<br />
<br /><br />
::*1 ul of purified PCR product <br />
::*1 ul of each stop oligo<br />
::*22 ul of water<br />
::*25 ul of Phusion PCR MasterMix<br />
<br /><br />
*run 25-cycle PCR according to the following protocol<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::65 °C/ 45 sec<br />
::72 °C/ 50 sec<br />
................................................ (25x)<br />
::72 °C/ 5 min<br />
................................................<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
<br /><br />
''' Gel Electrophoresis '''<br />
* PCR products from the 25 cycle PCR were analyzed on a Gel. Therefor, 5 ul of PCR product were mixed with 1 ul of 6x-loading dye and loaded on a 1.5 % agarose gel. In addition, 2.5 ul of the 7-cycle PCR (07/21/2010) and 12-cycle PCR were loaded as well. The gel ran at 135 V for 55 min.<br />
<br /><br /><br />
<br /><br /><br />
<br />
----<br />
<br />
== 22/07/2010 ==<br />
<br /><br />
* the PCR products from the previous days' raPCR were loaded on a 1 % agarose gel and the brightest 200, 400, 700 and 1400 bp bands were gel extracted using the Qiagen Gel Extraction Kit (elution in 32 ul of nuclease free water)<br />
* Vector pSB1AC3 (500 ng) and the gel extraction products were digested with EcoRI and SpeI according to the standard digestion protocol<br />
* PCR purification was performed for the digested raPCR products and a gel-extraction was performed for the ~ 3 kb vector band of pSB1AC3 (elution in 32 ul of nuclease-free water each)<br />
* 12 ligation reactions were performed using 5 or 10 ul of insert and 5 ul of vector in each reaction; standard ligation was performed<br />
<br /><br />
<br /><br />
----<br />
<br />
== 23/07/2010 ==<br />
<br /><br />
*transformation of ligation product (previous day) into E. coli Top10 cells according to the standard transformation protocol<br />
<br /><br />
<br /><br />
----<br />
<br />
== 26/07/2010 ==<br />
<br /><br />
* of 21 colonies, 7 of each hsa-mir-886_3p 200, 400 and 700 bp band cloning product and inocculation of Miniprep LB cultures<br />
<br /><br />
=== single binding site synthesis ===<br />
<br /><br />
In order to construct a database of synthetic single binding sites, we developed and optimized a standardized single binding site synthesis protocol;<br />
[[Image:singlebs1.png|thumb|400 px|right|The band at ~60 bp shows the synthesized single binding sites. For mir-886 and mir-122 there were some unspecific products or multimers obtained.]]<br />
*Protocol 1:<br />
:set up the following reaction<br />
:*1 ul of each single binding site oligo (100 uM) has-mir-886-3p, hsa-mir-886-3p(perf), hsa-mir-769-5p, hsa-mir-769-5p(perf), hsa-mir-122, hsa-mir-122(perf)<br />
:* 1 ul of SBSSSS_EcoRI primer (reverse strand synthesis primer)<br />
:* 23 ul of water<br />
:* 25 ul of Phusion PCR MasterMix<br />
PCR protocol:<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::60 °C/ 45 sec<br />
::72 °C/ 30 sec<br />
................................................ (30x)<br />
::72 °C/ 5 min<br />
................................................<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
*analysis of the result on a 2 % agarose gel, run 45 min @ 135 V<br />
<br />
<br /><br />
<br />
----<br />
<br />
== 27/07/2010 ==<br />
<br /><br />
[[Image:886colonyPCR.png|thumb|500 px|right|The 200, 400 and 1000 bp cloning products were analyzed in an analytic PCR. Only The very first sample of the 200 bp product seems to be positive, as it shows a higher band (~ 300 bp) compared to the religated vector product band at ~ 200 bp]]<br />
* Miniprep of the LB cultures inocculated the previous day<br />
* analytic PCR for detecting positive clones was set up according to the following protocol<br />
<br /><br />
:* 3 ul of Miniprep product<br />
:* 0.5 ul of each standard sequencing primer VF and VR<br />
:* 21 ul of water<br />
:* 25 ul of PCR Phusion Mastermix<br />
<br /><br />
PCR protocol:<br />
<br /><br />
................................................<br />
::95 °C/ 5 min<br />
................................................<br />
::95 °C/ 30 sec<br />
::60 °C/ 45 sec<br />
::72 °C/ 30 sec<br />
................................................ (30x)<br />
::72 °C/ 5 min<br />
................................................<br />
::4 °C/ forever<br />
................................................<br />
<br /><br />
*PCR products were analyzed on a 1 % agarose gel, run for 45 min @ 135 V<br />
<br /><br />
<br /><br />
<br /><br />
<br />
<br />
=== Single Binding Site Synthesis - Optimization ===<br />
*Further optimization of the single binding site synthesis protocol<br />
[[Image:singlebs2.png|thumb|400 px|right|The unspecific or multimer side products were clearly reduced, but there is still sime unwanted, longer product in case of mir-122.]]<br />
*Protocol 2:<br />
:set up the exact same reaction as on the day before, but using an anealing temperature of 65 °C<br />
*analysis of the result on a 2 % agarose gel, run 45 min @ 135 V<br />
<br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br />
<br /><br />
<br /><br />
----<br />
<br />
== 28/07/2010 ==<br />
[[Image:singlebs3.png|thumb|400 px|right|Nearly no unspecific/longer products can be seen. Thus, the synthesis protocol has been perfectly optimized.]]<br />
<br /><br />
*Further optimization of the single binding site synthesis protocol<br />
<br />
:set up the following reaction<br />
:*1 ul of each single binding site oligo (100 uM) has-mir-886-3p, hsa-mir-122<br />
:* 0.5 ul of SBSSSS_EcoRI primer (reverse strand synthesis primer)<br />
:* 23 ul of water<br />
:* 25 ul of Phusion PCR MasterMix<br />
<br /><br />
:* negative controls were performed with either the SBSSSS_EcoRI primer or the binding site oligos<br />
<br /><br />
*run PCR under the follwing different conditions<br />
:a) 30 cycles, annealing temperature 68 °C constant<br />
:b) touchdown PCR 68 °C (- 0.5°C each cycle)<br />
:c) incubation for 1 h @ 37 °C, then 30 cycle PCR with annealing temperature @ 65 °C<br />
<br /><br />
*The PCR product was analyzed on a 2 % agarose gel, run for 45 min @ 135 V<br />
<br /><br /><br />
=== raPCR for the construction of anti miRsAg-shRNA sponges ===<br />
[[Image:sponges1.png|thumb|750 px|center|In order to vary the length of the constructed sponges, three parameters were varied in the different PCRs: <br /> a) the stop oligos were either added before or after the 12 cycle PCR <br /> b) we used different amounts of binding site oligos (0.5, 1 or 1.5 ul each) <br /> c) different amounts of 12 cycle PCR product were used in the second, 25 cycle PCR (either 1 or 20 ul)]]<br />
<br />
* the reaction was set up according to the standard miRACLE protocol; either 0.5, 1 or 1.5 ul of each binding site oligo were used. 0.5 ul were either added to the first and second PCR reaction or were not present in the first, but the second PCR. For analysis, 5 ul of each PCR product were loaded on a 1 % agarose gel, run @ 135 V for 45 min<br />
<br />
<br /><br />
<br /><br />
<br /><br />
----<br />
<br />
== 31/07/2010 == <br />
<br /><br />
* ready-to-use vector pSB1A3 from the registry (25 ng/ul) digestion with EcoRI/PstI (NEB Buffer EcoRI + BSA, volume: 40 ul)<br />
* PCR purification of digestion product<br />
* subsequent digestion with DpnI (NEB Buffer 4, volume: 40 ul)<br />
* 5 ul of digestion product was analyzed on a 1 % agarose gel; unfortunately, there was no digestion product detectable (data not shown)<br />
<br /><br />
* transformation of pSB1A3-1 vector (Tom Knight, 2004) from the registry into Top10 cells according to the following protocol:<br />
:* 10 ul of nuclease-free water was pipetted into well C1 of Spring 2010 distribution plate 1<br />
:* incubation for 10 min at room temperature<br />
:* Top10 cells were thawn on ice (10 min) and 2 ul of DNA was added<br />
:* incubation on ice for 15 min<br />
:* 1 min heat-shock at 42 °C<br />
:* incubation on ince for 2 min<br />
:* adding 500 ul of LB media; mixing <br />
:* centrifugation of the cells (5 min, 6000 rpm)<br />
:* supernatant was removed, pellet resuspended in 50 ul LB media and cells were plated on a LB-Amp plate<br />
<br /><br />
* digestion of the 200 bp, 400 bp and 700 bp band from the previous day (corresponding to hsa-mir-886-3p microRNA binding site patterns constructed via diraPCR<br />
* no digestion product was detectable on the gel; therefor raPCR was repeated<br />
<br /><br />
=== diraPCR for constructing hsa-886-3p binding site patterns ===<br />
<br /><br />
* the diraPCR was pipetted according to the following protocol in three repeats:<br />
:* 1 ul of each binding site oligo<br />
:* 0.5 ul of each stop oligo<br />
:* 25 ul of Phusion MasterMix<br />
:* add water to final volume of 50 ul<br />
<br /><br />
* 12 cycle PCR was performed according to the standard miRACLE PCR protocol<br />
* after PCR purification the subsequent PCR reaction was pipetted as follows:<br />
:* 5, 10 or 20 ul of 12 cycle PCR prodcut<br />
:* 0.5 ul of each stop oligo<br />
:* 25 ul of Phusion MasterMix<br />
:* add water to final volume of 50 ul<br />
<br /><br />
*: the 25 cycle PCR was performed according to the standard miRACLE PCR protocol<br />
<br /><br />
<br /><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-28T03:17:02Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''24'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''25'''||'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||'''31'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
To create binding site (BS) patterns for micro RNAs (miRNAs) , we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team ([https://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters#RA-PCR_protocol see here]) and adopted it to our purposes.<br />
The differences:<br />
*Sequences from 100 to 400 base pairs are requested.<br />
*Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) BS recognition<br />
:*distance and sequence between miRBS (the spacer)<br />
<br />
<br />
See on our Notebook pages how we created binding site patterns.<br />
<br />
The adopted method for BS-patterns can be found on our [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#random_assembly_PCR_.28raPCR.29 methods page].<br />
<br />
On the [https://2010.igem.org/Team:Heidelberg/Parts#synthetic_microRNA_binding_Site_patterns_against_endogenous_miRNA Parts]-Page you can find standardized BS-patterns for hsa-mir-122 and has-mir-221, containing at least 2 binding sites.<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-28T03:14:21Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
== 02/10/2010 ==<br />
<br /><br />
*digestion in 50 µl of <br />
**4x pSB1C3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
**4x pSB1A3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
<br />
== 05/10/2010 ==<br />
<br /><br />
*1µg digestion of miMeasure and 6 different constructs (1A, 3F, 13, 15, 17, 37) with EcoRI and PstI<br />
<br />
:1= 0S<br />
:2= 0L<br />
:3= 10S<br />
:4= 10L<br />
<br />
<br />
== 06/10/2010 ==<br />
<br />
20 Miniprep:<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: 20 Minis'''<br />
|Number||binding site against miRNA x||Position<br />
|-<br />
|1||221||3.5<br />
|-<br />
|2||221||1.4<br />
|-<br />
|3||1179||3.1<br />
|-<br />
|4||4286||2.6<br />
|-<br />
|5||4286||4.1<br />
|-<br />
|6||4286||3.4<br />
|-<br />
|7||1179||4.4<br />
|-<br />
|8||1179|3.5<br />
|-<br />
|9||1179||1.9<br />
|-<br />
|10||221||4.6<br />
|-<br />
|11||221||1.5<br />
|-<br />
|12||4286||3.5<br />
|-<br />
|13||221||4.8<br />
|-<br />
|14||221||2.3<br />
|-<br />
|15||4286||2.2<br />
|-<br />
|16||4286||1.3<br />
|-<br />
|17||1179||2.5<br />
|-<br />
|18||1179||2.4<br />
|-<br />
|19||1179||1.5<br />
|-<br />
|20||1179||4.8<br />
|}<br />
<br />
* digestion of miMeasure and 6 different synthetic miRNA patterns against endogenous miR122<br />
* gel seperation<br />
* gel purification<br />
* sequencing<br />
----<br />
<br />
<br />
== 12/10/2010 ==<br />
<br />
4 miraPCRs for binding sites of miR4286.<br />
* one PCR with an annealing temperature of 45 degree and 16 cycles<br />
* second miraPCR with annealing temperature of 57 degree and also 16 cycles<br />
**nucleotide removal<br />
**digestion<br />
**gel seperation<br />
**gel purification<br />
**ligation in miMeasure and pSB1C3 <br />
**transformation<br />
<br />
== 13/10/2010 ==<br />
<br />
*pick colonies<br />
*about 8 hours later: do minipreps<br />
*send for sequencing<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:12:05Z<p>Kleinsorg: /* 08/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08-09/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:10:02Z<p>Kleinsorg: /* 29/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
:Spacer(0)<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
:Spacer(10)<br />
::* 3.7 - 2 binding sites - both ok<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T03:07:13Z<p>Kleinsorg: /* 28/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
<br />
<br />
== 28/09/2010 ==<br />
<br />
miR-122 samples were sent for sequencing (by GATC)<br><br />
1: 0S<br><br />
2: 0L<br><br />
3: 10S<br><br />
4: 10L<br><br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Modeling/mUTINGTeam:Heidelberg/Modeling/mUTING2010-10-28T02:57:58Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|mode_mispec}}<br />
<html><br />
<head><br />
<title>mUTING</title><br />
<br />
<style type="text/css"><br />
.largetext {font-size: 19px;}<br />
.titleorange{font-size: 22px; display:inline; font-weight:bolder; color: rgb(240,150,0);}<br />
.titleblue{font-size: 22px; display:inline; font-weight:bolder; color: rgb(0,155,225);}<br />
</style><br />
</head><br />
<body><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2010/c/c7/MUTING.png" width=250px></img><br><br><br />
<div class="titleblue">m</div><div class="titleorange">iRNA</div><div class="titleblue"> U</div><div class="titleorange">sage for </div><div class="titleblue">Ti</div><div class="titleorange">ssue Targeti</div><div class="titleblue">ng</div></center><br />
<br />
<br />
<br />
<iframe id="frame_muting" border="0" frameborder="0" style="border:none; background:transparent; width:890px; height:1200px;" src="http://igem.bioquant.uni-heidelberg.de/igem_2010/muting.html">Please enable iframes in your browser or use this link to <a href="http://igem.bioquant.uni-heidelberg.de/igem_2010/muting.html">mUTING</a><br />
</iframe><br />
</body><br />
</html><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Modeling/mUTINGTeam:Heidelberg/Modeling/mUTING2010-10-28T02:57:34Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|mode_mispec}}<br />
<html><br />
<head><br />
<title>mUTING</title><br />
<br />
<style type="text/css"><br />
.largetext {font-size: 19px;}<br />
.titleorange{font-size: 22px; display:inline; font-weight:bolder; color: rgb(240,150,0);}<br />
.titleblue{font-size: 22px; display:inline; font-weight:bolder; color: rgb(0,155,225);}<br />
</style><br />
</head><br />
<body><br />
<br />
<center><img src="https://static.igem.org/mediawiki/2010/c/c7/MUTING.png" width=250px></img><br><br><br />
<div class="titleblue">m</div><div class="titleorange">iRNA</div><div class="titleblue"> U</div><div class="titleorange">sage for </div><div class="titleblue">Ti</div><div class="titleorange">ssue Targeti</div><div class="titleblue">ng</div></center><br />
<br />
<br />
<br />
<iframe id="frame_muting" border="1" frameborder="1" style="border:solid; background:transparent; width:890px; height:1200px;" src="http://igem.bioquant.uni-heidelberg.de/igem_2010/muting.html">Please enable iframes in your browser or use this link to <a href="http://igem.bioquant.uni-heidelberg.de/igem_2010/muting.html">mUTING</a><br />
</iframe><br />
</body><br />
</html><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Modeling/miGUITeam:Heidelberg/Modeling/miGUI2010-10-28T02:49:10Z<p>Kleinsorg: Replacing page with '{{:Team:Heidelberg/Single}}
{{:Team:Heidelberg/Single_Pagetop|miGUI}}
<html>
<iframe id="frame_migui" border="1" frameborder="1" style="border:none; background:transparent; wi...'</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|miGUI}}<br />
<br />
<html><br />
<iframe id="frame_migui" border="1" frameborder="1" style="border:none; background:transparent; width:900px; height:1800px;" src="http://igem.bioquant.uni-heidelberg.de/igem_2010/gui.htm">Please enable iframes in your browser or use this link to <a href="http://igem.bioquant.uni-heidelberg.de/igem_2010/gui.html">miBEAT</a><br />
</iframe><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-28T02:45:31Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we created Spacer sequences with 10 or 20 nucleotides between the two halves. If we have time, we could then analyse the effect of the spacer sequence, additionially on the binding site pattern.<br />
<br />
Oligos were ordered corresponding to the [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR Primer Table]<br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ~ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ~ 2000 bp<br />
:::* Insert ~ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Modeling/miRockdownTeam:Heidelberg/Modeling/miRockdown2010-10-28T02:21:35Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|mirockdown}}<br />
<br />
=miRockdown=<br />
<html><br />
<iframe id="frame_miRockdown" border="0" frameborder="0" style="border:none; background:transparent; width:890px; height:900px;" src="http://igem.bioquant.uni-heidelberg.de/igem_2010/knockdown.html">Please enable iframes in your browser or use this link to <a href="http://igem.bioquant.uni-heidelberg.de/igem_2010/knockdown.html">miRockdown</a><br />
</iframe><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Modeling/miRockdownTeam:Heidelberg/Modeling/miRockdown2010-10-28T02:19:39Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|mirockdown}}<br />
<br />
=miRockdown=<br />
<html><br />
<iframe id="frame_miRockdown" border="0" style="border:none; background:transparent; width:890px; height:900px;" src="http://igem.bioquant.uni-heidelberg.de/igem_2010/knockdown.html">Please enable iframes in your browser or use this link to <a href="http://igem.bioquant.uni-heidelberg.de/igem_2010/knockdown.html">miRockdown</a><br />
</iframe><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T23:38:09Z<p>Kleinsorg: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#30.2F10.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#31.2F10.2F2010 31]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
To create binding site (BS) patterns for micro RNAs (miRNAs) , we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team ([https://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters#RA-PCR_protocol see here]) and adopted it to our purposes.<br />
The differences:<br />
*Sequences from 100 to 400 base pairs are requested.<br />
*Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) BS recognition<br />
:*distance and sequence between miRBS (the spacer)<br />
<br />
<br />
See on our Notebook pages how we created binding site patterns.<br />
<br />
The adopted method for BS-patterns can be found on our [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#random_assembly_PCR_.28raPCR.29 methods page].<br />
<br />
On the [https://2010.igem.org/Team:Heidelberg/Parts#synthetic_microRNA_binding_Site_patterns_against_endogenous_miRNA Parts]-Page you can find standardized BS-patterns for hsa-mir-122 and has-mir-221, containing at least 2 binding sites.<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/MethodsTeam:Heidelberg/Notebook/Methods2010-10-27T23:34:05Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_methods}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Methods=<br />
==Cloning==<br />
<br />
===Agarose Gel Electrophoresis===<br />
Agarose flat-bed gels in various concentrations (0.6–2% agarose in 0.5 x TAE buffer) and sizes were run to separate DNA fragments in an electrical field (10–20 V/cm) for analytical or preparative use. The desired amount of agarose was boiled in 1 x TAE buffer until it was completely dissolved. After it cooled down to approximately 60°C, ethidium bromide (EtBr) solution (0.5 µg/ml final concentration) was added to the liquid agar, which was then poured in a flat-bed tray with combs. As soon as the agarose solidified, the Running buffer (0.5 x TAE buffer) was added before the DNA in the loading buffer was loaded into the wells and separated electrophoretically. Ethidium bromide intercalates with the DNA’s GC ntss resulting in DNA-EtBr-complex that emits visible light. Therefore, the DNA fragments could be detected on a UV-light tray at 265 nm.<br />
<br><br><br />
<br />
===Colony PCR===<br />
<br />
Colony PCRs were performed using Fermentas PCR Master Mix (2x), containing ''Taq'' DNA Polymerase.<br/><br />
Bacterial colonies were picked form an LB/Agar-plate and either resuspended in PCR reaction mix and subsequently used to inoculate LB-medium with appropriate antibiotic, or resuspended in water. The water was then taken as "template" for PCR and inoculation of Minepreps.<br/><br />
The PCR was performed using 20 pmol of forward and reverse primer (= 0.2 µL of 100µM) in a total volume of 20&nbsp;µL.<br/><br />
PCR conditions were set to recommendations made by Fermentas:<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||03:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|94°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 30 cycles<br />
|-<br />
|45°'''*'''||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|01:00 /kb<br />
|-<br />
|72°||10:00||<br />
|-<br />
|4°||8||<br />
|}<br />
<br><br><br />
<br />
'''*'''with 45°C at a minimum of primer annealing temp<br />
<br />
===Plasmid-PCR===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|02:30<br />
|-<br />
|72°||10:00||<br />
|}<br />
<br />
===shRNA-PCR protocol===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||00:30||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:15<br />
|-<br />
|72°||1:00||<br />
|-<br />
|4°||forever||<br />
|}<br />
<br />
===Gel extraction===<br />
After gel electrophoresis the digested vector and insert have to be purified from the gel. With the help of a UV lamp, the bands were quickly excised from the gel without exposing the DNA too long to UV light. Afterwards the DNA was purified with the QIAquick Gel extraction kit. Three volumes of buffer QG were added to one volume of gel. The gel fragment was dissolved by incubation for 10 min at 50°C. Afterwards one volume of 100% isopropanol was added. The solution was applied on a QIAquick spin column after this has been placed into a provided 2 ml collection tube. By centrifugation for 1 min at 13.000 rpm the DNA was bound to the column. The flow-through was discarded and the column was placed in the same collection tube. To remove all traces of agarose from the column, 500 µl of wash buffer QC was added followed by centrifugation for 1 min at 13.000 rpm. The flow-through was discarded and the column was washed with 750 µl of buffer PE for 1 min at 13.000 rpm. Afterwards the flow-through was discarded. An additional centrifugation for 1 min at 13.000 rpm helped to remove the residual ethanol. The column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 30 µl of ddH2O.<br />
<br><br><br />
<br />
===Large scale preparation of plasmid DNA===<br />
150 ml LB-Medium with 150 µl ampicillin was inoculated with 50 µl of bacteria culture which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin MAxiprep kit from Qiagen and the protocol was followed. The overnight culture was centrifuged for 20 min at 4000 rpm at 4°C using an SLA 1500 Rotor. Afterwards the LB-medium was discarded and the pellet was homogeneously resuspended in 10 ml of precooled Buffer P1. After having added 10 ml of Buffer P2 the mixture was inverted 4-6 times and incubated for 5 min at RT before adding 10 ml of chilled Buffer P3. Thereafter the lysate was poured into a prepared QIAfilter Maxi Cartridge and incubated at RT for 10 min. During this time a QIAGEN-tip 500 was equilibrated by applying 10 ml of Buffer QBT and allowing the column to empty by gravity flow. The cell lysate was filtered into the QIAGEN-tip. The cleared lysate entered the resin by gravity flow and after washing with 2 x 30 ml Buffer QC the Plasmid DNA was eluted with 15 ml Buffer QF. After this the DNA was precipitated by adding 10.5 ml isopropanol and centrifuged at 4,000 rpm for 45 min at 4°C. The supernatant was discarded and the DNA pellet was washed with 5 ml ethanol (70%) and centrifuged at 4,000 rpm for 15 min. After air-drying the pellet the DNA was redissolved in H2O. <br><br />
<br><br />
<br />
===Plasmid-DNA isolation===<br />
5 ml LB-Medium with 5 µl ampicillin was inoculated with single colonies which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin Miniprep kit from Qiagen and following the manufacturer’s protocol. 4 ml of each overnight culture was pelleted in 2 ml microcentrifuge tubes during two steps of centrifugation at 13.000 rpm. Subsequently the pellet was resuspended in 250 µl of chilled buffer P1. 250 µl of lysis buffer P2 was added and the solution was mixed thoroughly by inverting the tube 4-6 times. After adding 350 µl of the neutralization Buffer N3 the solution was mixed immediately and thoroughly by inverting the tube 4-6 times. Thereafter the mixture was centrifuged. The supernatants were applied to a QIAprep column which was put in a 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. After adding 500 µl of wash buffer PB, it was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. Once more, it was washed with 750 µl of wash buffer PE. In an additional centrifugation for 1 min at 13.000 rpm the residual wash buffer was removed. The QIAprep column was placed into a clean 1.5 ml microcentrifuge tube and the plasmid DNA was eluted in 30 µl ddH2O.<br />
<br><br><br />
<br />
===Preparation of competent E. coli Top10 and DH5alpha===<br />
Plating of E. coli Top10 and DH5alpha on a agar plate (LB, without Amp); Preperation of competent cells according to the following protocol:<br />
<br />
First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl2. After addition of further 190 ml 100 mM CaCl2 the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl2 with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.<br />
<br /><br /><br />
<br />
===Purification of PCR product===<br />
One volume of buffer PBI was added to one volume of the PCR sample mix. The sample was applied to a QIAquick column which has been placed into a provided 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded and the column was placed in the same collection tube. After this 750 µl of buffer PE was added to wash the column. It was centrifuged for 1 min at 13.000 rpm. The flow-through was discarded and the column was placed in the same collection tube. It was centrifuged for 1 min at 13.000 rpm. Afterwards the QIAquick column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 40 µl ddH2O.<br />
<br><br><br />
<br />
<br />
===Sequencing===<br />
Performed by the GATC Biotech company<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br><br />
<br />
== random assembly PCR (raPCR) ==<br />
<br />
==== Designing Oligos ====<br />
<br />
To design Oligos for raPCR, first you need to have your miRNA sequence. This you can find on databases such as [http://www.microrna.org microRNA.org] or [http://mirbase.org mirbase.org]. Then you need to have an innert spacer sequence to seperate the binding sites from each other.<br />
Like we did, you can use following tools to create your own spacer sequence:<br />
:[http://cbit.snu.ac.kr/~miTarget/ http://cbit.snu.ac.kr/~miTarget/]<br />
:[http://cbcsrv.watson.ibm.com/rna22.html http://cbcsrv.watson.ibm.com/rna22.html]<br />
:[http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html]<br />
<br />
Or you choose the one we used: <span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Then the spacer need to be added to the miRNA binding site you want to use. In our approach, the spacer is also used for annealing of the different oligos. Therefore we suggest to split it in two parts. The first half (green) is then added to the 5' end and the second half (blue) is added to the 3' end of the miRBS sequence.<br />
<br />
For running the PCR you need to create annealing oligos, which could either be the spacer itself (reverse complement of firsthalf elongated with reverse complement of second half).<br />
<br />
Last but not least you need to have stop oligos. Stop oligos are characterised by having just one annealing sequence so, either first half or second half. Like for normal PCR Primers one annealing sequence should be reverse complemented, so they can also act effeciently as PCR primers. Additionally you can add whatever you want (i.e. the BBb-Standard sites). Those primers you can find in our [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR primer list].<br />
<br />
<br />
==== running the PCR ====<br />
<br />
<br \><br />
We developed a standardized PCR based method we use for the creation of our microRNA binding site patterns. It consists of two subsequent PCR steps: a 12 cycle PCR followed by a 25 cycle PCR. Therefor, order the oligos containing binding sites for the different microRNAs of your choice (refer to step 1). Furthermor, order the following diraPCR stop oligos:<br />
:*miraPCR_Stop(fw)_EcoRI: 5'-TTTGTCgaattcGGTAGCTATTTCTC-3'<br />
:*miraPCR_Stop(rev)_PstI: 5'-TTTGTCctgcagGAGAAATAGCTACC-3'<br />
*Dilute all oligos (including the stop oligos) to a final concentration of 100 um.<br />
*set up a PCR-reaction according to the following protocol. You can direct the length of your plasmid by applying more stop oligos (= shorter PCR fragments, that means patterns with lower amount of miR binding sites) and different amounts of binding site oligos.<br />
<br \><br />
''' 12-cycle PCR '''<br />
*set up a PCR reaction according to the following protocol<br />
<br /><br />
:*0.1-4 µl of Oligos (recommended: for binding site patterns of the same miRNA, use 3 µL)<br />
:*0-0.5 µLof each stop oligo (recommended: for shorter fragments use 0.5 µL)<br />
:*1 µL of spacer oligo<br />
:*25 µl of Phusion PCR MasterMix<br />
:*add water to a final volume of 50 µl<br />
<br /><br />
* run 12-cycle PCR according to the following program<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4°||forever||<br />
|}<br />
<br />
<br /><br />
*PCR purify all products applying a PCR purification Kit (Qiagen). We recommend elution in 30 µL for higher DNA concentration.<br />
<br /><br />
'''25-cycle PCR'''<br />
* run 25-cycle PCR in order to amplify constructs; therefor set up a PCR reaction according to the following protocol<br />
<br /><br />
:*1-20 µl of purified PCR product (for shorter patterns (100-500 bp, 20 ul are recommended)<br />
:*0.5-1 µl of each stop oligo <br />
:*25 µl of Phusion PCR MasterMix (2x)<br />
:*add water to final volume of 50 µl<br />
<br /><br />
*run 25-cycle PCR according to the following protocol<br />
<br /><br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4°||forever||<br />
|}<br />
<br><br><br />
<br />
==Cell culture==<br />
===Media===<br />
*HeLa - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK293T - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK T-REx - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 50µg/ml Zeocin<br />
*HEK T-REx (with pcDNA5 integrated) - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 100µg/ml Hygromycin<br />
*Huh7 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 1% Non-essential amino acids<br />
*HepG2 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*Hepa1.6 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*primary hepatocytes - William's Medium E, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 100nM Dexamethasone<br />
<br><br />
<br />
===Passaging===<br />
*remove media<br />
*wash cells one time in PBS (10ml)<br />
*remove PBS; add 2 ml of trypsin-EDTA solution and incubate cells for 5 min at 37 °C<br />
*add 5 ml of the according media<br />
*take 1/10th of the cell suspension and plate out on the according dish (either p100 dish, 6 well plate or T-flask)<br />
<br><br />
<br />
===Thawing===<br />
Thawing of Huh-7, HeLa p4 and HEK-293 cells according to the following protocol<br />
vials from liquid nitrogen were thawn at 37 °C<br />
once, the probe was nearly completely thawn, cells were thrown into pre-warmed DMEM (10 % FCS, L-Glut, P/S) and gentely mixed<br />
cells were spinned down at 800 rpm, 3 min; supernatant was discarded<br />
the pellett was resuspended in 10 ml DMEM an plated on a p100 cell culture dish in the following media according to the different cell lines:<br />
<br />
===Coating===<br />
For 96-well plates:<br />
*add 30 µl of poly-L-lysine solution (Sigma) to each well (make sure whole surface is covered with solution)<br />
*leave for 30' in the incubator<br />
*remove poly-L-lysine solution<br />
*wash once with 1x PBS<br />
<br><br />
<br />
===Transfection===<br />
====FuGENE====<br />
DAY1<br />
*seed cells<br />
DAY2 <br />
*transfection<br />
**to media (OptiMEM, no FBS) add [http://www.roche-applied-science.com/pack-insert/1815091a.pdf FuGENE 6 reagent] (it is important to add FuGENE to media, not other way round and not to drop FuGENE on the walls of the tube)<br />
**incubate 5 minutes at room temperature<br />
**add DNA<br />
**incubate 15 minutes<br />
**mix well and add dropwise to the well<br />
<br/><br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc<br />
!culture format!!number of cells seeded!!volume of culture media!!amount of DNA!!volume of FuGENE!!volume of media for FuGENE activation<br />
|-<br />
|96-well||5 000||100µl||50ng||0.3µl||5µl<br />
|-<br />
|24-well||30 000||500µl||200ng||0.6µl||20µl<br />
|-<br />
|6-well||100 000||2500µl||1000ng||3µl||100µl<br />
|-<br />
|labtec chamber||10 000||400µl||200ng||0.4µl||20µl<br />
|-<br />
|}<br />
<br />
<br/><br />
====PEI====<br />
150cm<sup>2</sup> plate format<br />
*mixture 1:<br />
**44ug DNA<br />
**up to 790µl of H2O each flask<br />
**add 790µl of 300mM NaCl<br />
*mixture 2:<br />
**343µl of PEI<br />
**790µl of 300mM NaCl<br />
**add mixture 2 to mixture 1<br />
**incubate 10 min at RT<br />
**add to cells<br />
<br><br />
<br />
====HBSS====<br />
150cm<sup>2</sup> flask format<br />
*50ugDNA<br />
*2.67ml 250mM CaCl<sub>2</sub><br />
*2.67ml 2x HBSS<br />
<br />
*warm up both CaCl<sub>2</sub> and HBSS<br />
*add plasmid to CaCl<sub>2</sub> solution<br />
*pour 2x HBSS to erlenmeyer flask<br />
*very slowly add CaCl<sub>2</sub> to HBSS, mix vigorously during adding (should become turbid)<br />
*incubate for one minute in the room temperature<br />
*add transfection mix to media (1 volume of mix, 2 volumes of media)<br />
*pour on cells<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
<br />
== Virus Production ==<br />
<br />
:'''Seeding'''<br />
Virus production was done in 150cm<sup>2</sup> flasks. 0.9 million cells were seeded in 30ml medium per flask. Transfections were done as described [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection above]. <br />
:'''Harvesting'''<br />
To harvest the cells, cell suspension was decanted into 500ml corning conical centrifuge tubes. Remaining cells were washed with 19ml PBS and also transferred into the tubes. Cells were collected by centrifugation at 1500rpm for 15min at 4°C. Supernatant was aspirated, cells resuspended in 10ml 1xPBS and transferred into a 50ml blue-cap vial. Centrifugaion as above, aspiration of supernatant. Pellet was then resuspended in 5ml virus lysate solution and frozen at -196°C in liquid nitrogen for 5min, then thawed at 37°C. This freeze/thaw cycle was repeated five times.<br />
:'''Purification'''<br />
Each sample was sonicated in a sonication bath for 1min 20s, 50µg/ml benzonase was added. Samples were kept at 37°C for 30min and vortexed every 10min. Centrifugation for 15min at 3270g, 4°C. Supernatant was transferred in to a new blue cap vial with a 5ml pipette. Gradiant was poured in a Beckman Quick-Seal centrifuge tube and a pasteur pipette plugged into the tube. 5ml of the virus suspension was transferred through the Pasteur pipette into the tube. 1.5ml 15% Iodixanolsolution (in PBS-MK) was poured through the Pasteur pipette in a way thet it presses put the virus suspension. In the same manner, 1.5ml 25% Iodixanolsolution was pipette to become the lower phase, then 1.5ml 40% Iodixanolsolution and finally 1.5ml 60% Iodixanolsolution. The Pasteur pipette was reomeved and the tubes sealed with tube sealer. Ultracentrifulation for 2h at 50.000rpm, 4°C and 71,1 Ti. The virus was recovered from the 40% Iodixanol phase.<br />
<br />
Seeding medium: DMEM high glucose, 10% FCS, 1% P/S, 1% L-Glutamin<br />
Virus lysate solution<br />
PBS-MK: 1xPBS, 1mM MgCl<sub>2</sub>, 2.5mM KCl<br />
Iodixanolsolution<br />
<br />
<br />
=== Quantitative Realtime PCR ===<br />
<br />
To quantitavely measure the amount of AAV rep gene, viruses had to be lysed. First, 10µl TE buffer was mixed with 10µl AAV solution. 20µl 2M NaOH were added and incubated for 30min at 56°C to lyse the viruses. Then 38µl 1M HCl and 922µl H<sub>2</sub>O were added. For a negative control, the same procedure was done with 10µl H<sub>2</sub>O instead of virus. <br />
<br />
For each probe, a 35µl mix of RNase free water, 1x SensiMix II Probe PCR Master Mix, 100pmol/µl forward and reverse primer and 100pm/µl probe was prepared in RNase free water. This was enough for measurement triplicates. To make a RT-PCR standard curve, the standard probes were diluted to concentrations of 3.5x10<sup>11</sup> to 3.5x10<sup>3</sup> molecules in 10µl. <br />
<br />
Thermocycler program was 10min at 95°C initial activation, followed by 40 cycles of 10s at 95°C and 20s at 60°C. <br />
<br />
To find out the concentration of viral genomes per ml (<font face="Symbol">Y</font>) the value of the <font face="Symbol">X</font> position on the standard curve has to be multiplied as follows: <font face="Symbol">Y</font> = <font face="Symbol">X</font> &times;10&sup2; &times;10&sup2;<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
== Measurements ==<br />
=== ELISA ===<br />
==== Procedure ====<br />
# Coating<br />
#* dilute 1st antibody 1<nowiki>:</nowiki>1000 in coating buffer<br />
#* add 50 µl per well<br />
#* incubate over night at 4°C<br />
# Blocking<br />
#* wash three times with 300 µl wash buffer per well<br />
#* add 200 µl blocking buffer per well<br />
#* incubate more than 1 hour at room temperature<br />
#** alternative: over-night at 4°C or freezing at -20°C<br />
# Sample Loading<br />
#* 50 µl per well<br />
#* incubate 2 hours at 37°C<br />
#* wash five times<br />
# Detection<br />
#* dilute 2nd antibody 1:1000 in dilution buffer<br />
#* add 100 µl per well<br />
#* incubate 1 hour at 37°C<br />
#* wash five times<br />
#* add 100 µl substrate per well<br />
#* incubate at room temperature for 5 - 10 min<br />
#* stop with 100µl 2M H<sub>2</sub>SO<sub>4</sub> per well<br />
#* read absorbance at 450 nm wavelength<br />
<br><br />
==== Buffers ====<br />
*'''Coating Buffer''' (0.1M NaHCO<sub>3</sub>, 0.1M Na<sub>2</sub>CO<sub>3</sub>, pH 9.5) <br />
<br />
*'''Diluting/Blocking Buffer (db)''' (0.25 ml Tween 20, 30 g BSA, add 1x PBS to 500 ml)<br />
<br />
*'''Wash Buffer''' (0.5 ml Tween 20, 1L PBS 1x)<br />
<br />
<br />
:'''Calibration'''<br />
* 960 µl db + 40 µl pooled plasma = 200 ng/ml<br />
* add 500 µl of above into 500 µl of db = 100 ng/ml<br />
* serial dilutions continued down to 1.5625 ng/ml<br />
<br />
<br />
:'''Detection reagents'''<br />
* TMB Substrate Kit (Pierce, Thermo Scientific)<br />
* 2M H<sub>2</sub>SO<sub>4</sub><br />
<br><br />
<br />
=== Microscopy ===<br />
<br />
We used microscopy to measure EGFP and EBFP2 fluorescence intensity. Fluorescence was first evaluated using the Leica DM IRB epifluorescence microscope. Only cells which were transfected successfully were measured. First, the cells were washed with 1x PBS and detached from the plate using trypsin. 30µl trypsin was added to each well, incubated for ten minutes at room temperature. Cells were resuspended in 170µl 1%BSA in PBS and replicates for each condition were pooled into 8-well coverslip chambers. 100-150µl were used for confocal microscopy. <br />
<br />
Single cell images were obtained using a Leica TCS SP5 laser scanning confocal microscope (LSCM) and alternatively a Leica TCS SP2 LSCM. EGFP fluorescence was excited by the 488nm laserline of an Argon laser and measured between 520 and 560nm, EBFP2 proteins were excited by UV laser at 405nm and measured between 440 and 460nm. Pictures were taken sequentially line by line in two different channels for EGFP, EBFP2. Bright field was acquired at the same time as the EBFP2 signal from the 405nm laser. <br />
<br />
<br />
[[Image:panel.jpg|thumb|400px|center|'''HeLa cells two days after transfection with miMeasure''' (A) fluorescence signal GFP channel, 8bit; (B) fluorescence signal BFP channel, 8bit; (C) merge of channels A and B, RGB (D) cells after segmentation and automated cell counting and annotation]]<br />
<br />
To analyze the fluorescence of single cells, we segmented the images using ImageJ. In 8bit pictures, we set the threshold for each channel to 50, thereby filtering the background. This allowed us to annotate cells automatically using the “analyze particles” tool. Then we were able to get the fluorescence intensity for each single cell on each channel (EGFP or EBFP2) as an 8bit output, i.e. a value between 50 and 255. Panel 1 shows an example of one such image in different channels and after segmentation. From the data thus obtained, we calculated the EGFP:EBFP2 ratios for each cell using a simple algorithm. This enables us to visualize the mean of these ratios in a bar plot or to use all the data for linear regression curve calculation.<br />
<br />
* Consumables and Chemicals<br />
PerkinElmer ViewPlate, product number: 6004920<br><br />
Nunc Lab-Tek coverglass chamber, product number: 155411<br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4)<br><br />
0.05% Trypsin-EDTA, Invitrogen GIBCO, product number: 15400054<br><br />
<br />
* Instruments<br />
Leica DM IRB<br><br />
Leica SP5<br><br />
Leica SP2<br><br />
ImageJ version 1.43<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br />
<br />
=== Flow cytometry ===<br />
<br />
We used flow cytometry to analyse the EGFP and EBFP2 fluorescence intensities. Cells grown in a 96 well plate were washed once with 1xPBS and then trypsinised. Afterwards they were resuspended in PBS + 1% BSA and analyzed. EGFP and EBFP2 cellular intensities were measured with a flow cytometer was performed equipped with two laser diodes, one at 405nm and one at 488nm. The fluorescence of EGFP and EBFP2 was separated at 495nm by a dichroic mirror. Each signal was filtered through two emission filters: the first with the band pass between 425nm and 475nm to detect EBFP2, the second between 497.5nm and 522.5nm to detect EGFP. The bleed through was compensated by measuring cells only expressing EGFP and accordingly EBFP2. For the measurements 100µl cells in PBS + 1% BSA were pumped by the machine and about 10000 cells were analysed for each construct.<br />
<br />
<br />
* Consumables and Chemicals<br />
Falcon Becton Dickinson Microtest 96, product number: 353072 <br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4) <br><br />
Bovine Serum Albumine, Sigma, product number: A9647 <br><br />
<br />
<br />
* Instruments<br />
Beckman Coulter Cytomics FC500MPL<br />
<br />
<br />
*Analysis<br />
The reduction of EGFP expression compared to EBFP2 that we observed by flow cytometry could be quantitated as follow: two-dimensional scatter count plots representing cell counts for each EBFP2-EGFP intensity pair on a linear scale were exported as 64X64 pixel images. To ignore non-transfected cells, a square of 3X3 pixel originating from (0,0), where control non-transfected cells accumulate, was put to zero in each count plot. A ratio image of the same size containing the EGFP-EBFP2 intensity ratio for each pixel was generated. The mean ratio was estimated by multiplying each count plot with the ratio image, measuring the total image intensity and dividing it by the total count of each count plot. For the standard deviation, the mean intensity of a count plot was subtracted to the ratio image. the square of each pixel intensity was multiplied by the corresponding count and the total intensity of the result was divided by the total count. The standard deviation was then calculated by taking the square root of this number. All steps were performed on imageJ. <br />
<br />
<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
=== Dual Luciferase Assay ===<br />
We measured the knockdown of firefly luciferase using the [http://www.promega.com/tbs/tm046/tm046.pdf Promega Dual Luciferase Reporter Assay]. <br />
The DLR™ Assay System provides an efficient mean of performing dual-reporter assays, where the activities of firefly (<i>Photinus pyralis</i>) and Renilla (<i>Renilla reniformis</i>) luciferases (RL) are measured sequentially from a single sample. Firefly and Renilla luciferases can be used as a good reporter system, as those two enzymes have dissimilar enzyme structures and substrate requirements. This allows for selective discrimination between their bioluminescent reactions. The firefly luciferase (FL) reporter is measured first by adding Luciferase Assay Reagent II (LAR II) to generate a stabilized luminescent signal. After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is simultaneously initiated by adding Stop & Glo® Reagent to the same tube. The Stop & Glo® Reagent also produces a stabilized signal from the Renilla luciferase, which decays slowly over the course of the measurement. Here, Renilla luciferase is used for normalization. The measurements were conducted on the Promega GLOMAX 96 Microplate Luminometer using the Promega standard protocol ([https://2010.igem.org/Team:Heidelberg/Project/References#Materials_and_Methods Sherf et al., 1996]). <br><br />
Twenty hours after transfection, cells were washed with 1x PBS and lysed using 1x Passive Lysis Buffer (5x stock solution diluted with distilled water), shaking for 30 minutes at 37°C. 10µl of the lysate were transferred to a white microplate (LumaPlate) as required for Luminometer measurements. <br />
<br />
LAR II reagent was prepared by resuspending Luciferase Assay Substrate in 10ml Luciferase Assay Buffer II. For Stop & Glo reagent, 2.1ml 50x Stop & Glo substrate and 105ml Stop & Glo Buffer were added to the amber Stop & Glo reagent bottle and mixed by vortexing. Reagents where stored in 15ml aliquots at -80°C and thawed freshly prior to each measurement.<br />
<br />
To set up the Luminometer, the two injectors where flushed with distilled water, 70% ethanol, again water and air, three times each. Afterwards, they were primed three times with substrate reagents. <br />
<br />
The activity of the first luciferase (firefly) was measured by adding 25µl of LAR II reagent to the well. The enzyme reacts upon translation without further processing and oxidates beetle luciferin, resulting in photon emission that can be measured. In addition to beetle luciferin, the LAR II reagent contains coenzyme A, which accelerates the reaction and thus creates a prolonged luminescence signal. The luminescence was measured two seconds after addition of the reagent, for ten seconds. Afterwards, 25µl Stop & Glo reagent was added, which is able to quench the firefly luciferase activity and simultaneously contains the substrate for Renilla luciferase, coelenterazine. This second reaction also emits photons upon oxidation of the substrate. Addition of substrates and light emission measurements were conducted automatically by the GLOMAX Luminometer.<br />
<br><br />
==== Order of recording and processing raw data ====<br />
# triple-transfection of the following constructs in ratio 10:1:1<br />
#* shRNA-like miRNA (shRNA miR) expressing plasmid (25 ng / well)<br />
#* reference construct containing hRluc (2.5 ng / well)<br />
#* tuning construct with Luc2 fused to binding site referring to shRNA miR (2.5 ng / well)<br />
#: note: used backbones for all constructs were either pBS_U6 or pBS_H1<br />
# measurement of bioluminescent signal after substrate addition<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_date_samples_ctrl_BB.xls<br />
## first injection: LARII<br />
##* quantification of Firefly signal<br />
## second injection: Stop & Glo® Reagent<br />
##* quantification of Renilla signal<br />
# calculate signal ratio: Firefly/Renilla<br />
#: note: Renilla is used as a reference, Firefly signal determines binding site strength<br />
#* controls on every plate: perfect binding site (lower expression limit), no binding site (upper expression limit = 100%) defining overall expression range<br />
#* another control: separate triple-transfections of tuning constructs with a shRNA miR expression plasmid that is ''not'' corresponding to the binding site on the tuning construct (upper expression limit)<br />
# normalization by control without binding site<br />
#* thus, normalized value corresponds to knockdown percentage<br />
# deviation of knockdown percentage for corresponding shRNA miR by referring knockdown percentage of non-corresponding shRNA miR<br />
# calculate mean values and standard deviation (out of eight replicates) for each construct containing imperfect binding site (intermediate expression)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: plate#_process_BB_shRNA.xls<br />
#* note: error propagation has to be taken into account<br />
# grade calculated knockdown percentages in ascending order (lowest value always for perfect binding site, whereas maximum value without binding site)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_BB_final.xlsx<br />
<br/><br />
===== nomenclature =====<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|'''table 1''': Used nomenclature for raw data files.<br />
| abbreviation||meaning||example<br />
|-<br />
|shRNA||expressed shRNA miR||shRNA miR against hAAT ("hAAT")<br />
|-<br />
|date||date of measurement in format YYYYMMDD||20101026<br />
|-<br />
|samples||internal ID of constructs||M1-M6<br />
|-<br />
|BB||plasmid backbone||either pBS_U6 ("U6") or pBS_H1 ("H1")<br />
|-<br />
|plate#||number of measured 96 well plate||plate1<br />
|-<br />
|}<br />
<br/><br />
<br />
==== Consumables and Reagents ====<br />
LumaPlate, PerkinElmer, catalogue number 6005630<br><br />
[http://www.promega.com/tbs/tm046/tm046.pdf, Promega Dual-Luciferase® Reporter Assay System], catalogue number E1910<br />
<br><br />
<br />
==== Instruments ====<br />
Promega GLOMAX 96 Microplate Luminometer<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/MethodsTeam:Heidelberg/Notebook/Methods2010-10-27T23:26:15Z<p>Kleinsorg: /* random assembly PCR */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_methods}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Methods=<br />
==Cloning==<br />
<br />
===Agarose Gel Electrophoresis===<br />
Agarose flat-bed gels in various concentrations (0.6–2% agarose in 0.5 x TAE buffer) and sizes were run to separate DNA fragments in an electrical field (10–20 V/cm) for analytical or preparative use. The desired amount of agarose was boiled in 1 x TAE buffer until it was completely dissolved. After it cooled down to approximately 60°C, ethidium bromide (EtBr) solution (0.5 µg/ml final concentration) was added to the liquid agar, which was then poured in a flat-bed tray with combs. As soon as the agarose solidified, the Running buffer (0.5 x TAE buffer) was added before the DNA in the loading buffer was loaded into the wells and separated electrophoretically. Ethidium bromide intercalates with the DNA’s GC ntss resulting in DNA-EtBr-complex that emits visible light. Therefore, the DNA fragments could be detected on a UV-light tray at 265 nm.<br />
<br><br><br />
<br />
===Colony PCR===<br />
<br />
Colony PCRs were performed using Fermentas PCR Master Mix (2x), containing ''Taq'' DNA Polymerase.<br/><br />
Bacterial colonies were picked form an LB/Agar-plate and either resuspended in PCR reaction mix and subsequently used to inoculate LB-medium with appropriate antibiotic, or resuspended in water. The water was then taken as "template" for PCR and inoculation of Minepreps.<br/><br />
The PCR was performed using 20 pmol of forward and reverse primer (= 0.2 µL of 100µM) in a total volume of 20&nbsp;µL.<br/><br />
PCR conditions were set to recommendations made by Fermentas:<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||03:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|94°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 30 cycles<br />
|-<br />
|45°'''*'''||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|01:00 /kb<br />
|-<br />
|72°||10:00||<br />
|-<br />
|4°||8||<br />
|}<br />
<br><br><br />
<br />
'''*'''with 45°C at a minimum of primer annealing temp<br />
<br />
===Plasmid-PCR===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|02:30<br />
|-<br />
|72°||10:00||<br />
|}<br />
<br />
===shRNA-PCR protocol===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||00:30||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:15<br />
|-<br />
|72°||1:00||<br />
|-<br />
|4°||forever||<br />
|}<br />
<br />
===Gel extraction===<br />
After gel electrophoresis the digested vector and insert have to be purified from the gel. With the help of a UV lamp, the bands were quickly excised from the gel without exposing the DNA too long to UV light. Afterwards the DNA was purified with the QIAquick Gel extraction kit. Three volumes of buffer QG were added to one volume of gel. The gel fragment was dissolved by incubation for 10 min at 50°C. Afterwards one volume of 100% isopropanol was added. The solution was applied on a QIAquick spin column after this has been placed into a provided 2 ml collection tube. By centrifugation for 1 min at 13.000 rpm the DNA was bound to the column. The flow-through was discarded and the column was placed in the same collection tube. To remove all traces of agarose from the column, 500 µl of wash buffer QC was added followed by centrifugation for 1 min at 13.000 rpm. The flow-through was discarded and the column was washed with 750 µl of buffer PE for 1 min at 13.000 rpm. Afterwards the flow-through was discarded. An additional centrifugation for 1 min at 13.000 rpm helped to remove the residual ethanol. The column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 30 µl of ddH2O.<br />
<br><br><br />
<br />
===Large scale preparation of plasmid DNA===<br />
150 ml LB-Medium with 150 µl ampicillin was inoculated with 50 µl of bacteria culture which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin MAxiprep kit from Qiagen and the protocol was followed. The overnight culture was centrifuged for 20 min at 4000 rpm at 4°C using an SLA 1500 Rotor. Afterwards the LB-medium was discarded and the pellet was homogeneously resuspended in 10 ml of precooled Buffer P1. After having added 10 ml of Buffer P2 the mixture was inverted 4-6 times and incubated for 5 min at RT before adding 10 ml of chilled Buffer P3. Thereafter the lysate was poured into a prepared QIAfilter Maxi Cartridge and incubated at RT for 10 min. During this time a QIAGEN-tip 500 was equilibrated by applying 10 ml of Buffer QBT and allowing the column to empty by gravity flow. The cell lysate was filtered into the QIAGEN-tip. The cleared lysate entered the resin by gravity flow and after washing with 2 x 30 ml Buffer QC the Plasmid DNA was eluted with 15 ml Buffer QF. After this the DNA was precipitated by adding 10.5 ml isopropanol and centrifuged at 4,000 rpm for 45 min at 4°C. The supernatant was discarded and the DNA pellet was washed with 5 ml ethanol (70%) and centrifuged at 4,000 rpm for 15 min. After air-drying the pellet the DNA was redissolved in H2O. <br><br />
<br><br />
<br />
===Plasmid-DNA isolation===<br />
5 ml LB-Medium with 5 µl ampicillin was inoculated with single colonies which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin Miniprep kit from Qiagen and following the manufacturer’s protocol. 4 ml of each overnight culture was pelleted in 2 ml microcentrifuge tubes during two steps of centrifugation at 13.000 rpm. Subsequently the pellet was resuspended in 250 µl of chilled buffer P1. 250 µl of lysis buffer P2 was added and the solution was mixed thoroughly by inverting the tube 4-6 times. After adding 350 µl of the neutralization Buffer N3 the solution was mixed immediately and thoroughly by inverting the tube 4-6 times. Thereafter the mixture was centrifuged. The supernatants were applied to a QIAprep column which was put in a 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. After adding 500 µl of wash buffer PB, it was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. Once more, it was washed with 750 µl of wash buffer PE. In an additional centrifugation for 1 min at 13.000 rpm the residual wash buffer was removed. The QIAprep column was placed into a clean 1.5 ml microcentrifuge tube and the plasmid DNA was eluted in 30 µl ddH2O.<br />
<br><br><br />
<br />
===Preparation of competent E. coli Top10 and DH5alpha===<br />
Plating of E. coli Top10 and DH5alpha on a agar plate (LB, without Amp); Preperation of competent cells according to the following protocol:<br />
<br />
First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl2. After addition of further 190 ml 100 mM CaCl2 the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl2 with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.<br />
<br /><br /><br />
<br />
===Purification of PCR product===<br />
One volume of buffer PBI was added to one volume of the PCR sample mix. The sample was applied to a QIAquick column which has been placed into a provided 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded and the column was placed in the same collection tube. After this 750 µl of buffer PE was added to wash the column. It was centrifuged for 1 min at 13.000 rpm. The flow-through was discarded and the column was placed in the same collection tube. It was centrifuged for 1 min at 13.000 rpm. Afterwards the QIAquick column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 40 µl ddH2O.<br />
<br><br><br />
<br />
<br />
=== random assembly PCR ===<br />
<br />
==== Designing Oligos ====<br />
<br />
To design Oligos for raPCR, first you need to have your miRNA sequence. This you can find on databases such as [http://www.microrna.org microRNA.org] or [http://mirbase.org mirbase.org]. Then you need to have an innert spacer sequence to seperate the binding sites from each other.<br />
Like we did, you can use following tools to create your own spacer sequence:<br />
:[http://cbit.snu.ac.kr/~miTarget/ http://cbit.snu.ac.kr/~miTarget/]<br />
:[http://cbcsrv.watson.ibm.com/rna22.html http://cbcsrv.watson.ibm.com/rna22.html]<br />
:[http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html]<br />
<br />
Or you choose the one we used: <span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Then the spacer need to be added to the miRNA binding site you want to use. In our approach, the spacer is also used for annealing of the different oligos. Therefore we suggest to split it in two parts. The first half (green) is then added to the 5' end and the second half (blue) is added to the 3' end of the miRBS sequence.<br />
<br />
For running the PCR you need to create annealing oligos, which could either be the spacer itself (reverse complement of firsthalf elongated with reverse complement of second half).<br />
<br />
Last but not least you need to have stop oligos. Stop oligos are characterised by having just one annealing sequence so, either first half or second half. Like for normal PCR Primers one annealing sequence should be reverse complemented, so they can also act effeciently as PCR primers. Additionally you can add whatever you want (i.e. the BBb-Standard sites). Those primers you can find in our [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR primer list].<br />
<br />
<br />
==== running the PCR ====<br />
<br />
<br \><br />
We developed a standardized PCR based method we use for the creation of our microRNA binding site patterns. It consists of two subsequent PCR steps: a 12 cycle PCR followed by a 25 cycle PCR. Therefor, order the oligos containing binding sites for the different microRNAs of your choice (refer to step 1). Furthermor, order the following diraPCR stop oligos:<br />
:*miraPCR_Stop(fw)_EcoRI: 5'-TTTGTCgaattcGGTAGCTATTTCTC-3'<br />
:*miraPCR_Stop(rev)_PstI: 5'-TTTGTCctgcagGAGAAATAGCTACC-3'<br />
*Dilute all oligos (including the stop oligos) to a final concentration of 100 um.<br />
*set up a PCR-reaction according to the following protocol. You can direct the length of your plasmid by applying more stop oligos (= shorter PCR fragments, that means patterns with lower amount of miR binding sites) and different amounts of binding site oligos.<br />
<br \><br />
''' 12-cycle PCR '''<br />
*set up a PCR reaction according to the following protocol<br />
<br /><br />
:*0.1-4 µl of Oligos (recommended: for binding site patterns of the same miRNA, use 3 µL)<br />
:*0-0.5 µLof each stop oligo (recommended: for shorter fragments use 0.5 µL)<br />
:*1 µL of spacer oligo<br />
:*25 µl of Phusion PCR MasterMix<br />
:*add water to a final volume of 50 µl<br />
<br /><br />
* run 12-cycle PCR according to the following program<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4°||forever||<br />
|}<br />
<br />
<br /><br />
*PCR purify all products applying a PCR purification Kit (Qiagen). We recommend elution in 30 µL for higher DNA concentration.<br />
<br /><br />
'''25-cycle PCR'''<br />
* run 25-cycle PCR in order to amplify constructs; therefor set up a PCR reaction according to the following protocol<br />
<br /><br />
:*1-20 µl of purified PCR product (for shorter patterns (100-500 bp, 20 ul are recommended)<br />
:*0.5-1 µl of each stop oligo <br />
:*25 µl of Phusion PCR MasterMix (2x)<br />
:*add water to final volume of 50 µl<br />
<br /><br />
*run 25-cycle PCR according to the following protocol<br />
<br /><br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4°||forever||<br />
|}<br />
<br><br><br />
<br />
===Sequencing===<br />
Performed by the GATC Biotech company<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br><br />
<br />
==Cell culture==<br />
===Media===<br />
*HeLa - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK293T - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK T-REx - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 50µg/ml Zeocin<br />
*HEK T-REx (with pcDNA5 integrated) - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 100µg/ml Hygromycin<br />
*Huh7 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 1% Non-essential amino acids<br />
*HepG2 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*Hepa1.6 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*primary hepatocytes - William's Medium E, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 100nM Dexamethasone<br />
<br><br />
<br />
===Passaging===<br />
*remove media<br />
*wash cells one time in PBS (10ml)<br />
*remove PBS; add 2 ml of trypsin-EDTA solution and incubate cells for 5 min at 37 °C<br />
*add 5 ml of the according media<br />
*take 1/10th of the cell suspension and plate out on the according dish (either p100 dish, 6 well plate or T-flask)<br />
<br><br />
<br />
===Thawing===<br />
Thawing of Huh-7, HeLa p4 and HEK-293 cells according to the following protocol<br />
vials from liquid nitrogen were thawn at 37 °C<br />
once, the probe was nearly completely thawn, cells were thrown into pre-warmed DMEM (10 % FCS, L-Glut, P/S) and gentely mixed<br />
cells were spinned down at 800 rpm, 3 min; supernatant was discarded<br />
the pellett was resuspended in 10 ml DMEM an plated on a p100 cell culture dish in the following media according to the different cell lines:<br />
<br />
===Coating===<br />
For 96-well plates:<br />
*add 30 µl of poly-L-lysine solution (Sigma) to each well (make sure whole surface is covered with solution)<br />
*leave for 30' in the incubator<br />
*remove poly-L-lysine solution<br />
*wash once with 1x PBS<br />
<br><br />
<br />
===Transfection===<br />
====FuGENE====<br />
DAY1<br />
*seed cells<br />
DAY2 <br />
*transfection<br />
**to media (OptiMEM, no FBS) add [http://www.roche-applied-science.com/pack-insert/1815091a.pdf FuGENE 6 reagent] (it is important to add FuGENE to media, not other way round and not to drop FuGENE on the walls of the tube)<br />
**incubate 5 minutes at room temperature<br />
**add DNA<br />
**incubate 15 minutes<br />
**mix well and add dropwise to the well<br />
<br/><br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc<br />
!culture format!!number of cells seeded!!volume of culture media!!amount of DNA!!volume of FuGENE!!volume of media for FuGENE activation<br />
|-<br />
|96-well||5 000||100µl||50ng||0.3µl||5µl<br />
|-<br />
|24-well||30 000||500µl||200ng||0.6µl||20µl<br />
|-<br />
|6-well||100 000||2500µl||1000ng||3µl||100µl<br />
|-<br />
|labtec chamber||10 000||400µl||200ng||0.4µl||20µl<br />
|-<br />
|}<br />
<br />
<br/><br />
====PEI====<br />
150cm<sup>2</sup> plate format<br />
*mixture 1:<br />
**44ug DNA<br />
**up to 790µl of H2O each flask<br />
**add 790µl of 300mM NaCl<br />
*mixture 2:<br />
**343µl of PEI<br />
**790µl of 300mM NaCl<br />
**add mixture 2 to mixture 1<br />
**incubate 10 min at RT<br />
**add to cells<br />
<br><br />
<br />
====HBSS====<br />
150cm<sup>2</sup> flask format<br />
*50ugDNA<br />
*2.67ml 250mM CaCl<sub>2</sub><br />
*2.67ml 2x HBSS<br />
<br />
*warm up both CaCl<sub>2</sub> and HBSS<br />
*add plasmid to CaCl<sub>2</sub> solution<br />
*pour 2x HBSS to erlenmeyer flask<br />
*very slowly add CaCl<sub>2</sub> to HBSS, mix vigorously during adding (should become turbid)<br />
*incubate for one minute in the room temperature<br />
*add transfection mix to media (1 volume of mix, 2 volumes of media)<br />
*pour on cells<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
<br />
== Virus Production ==<br />
<br />
:'''Seeding'''<br />
Virus production was done in 150cm<sup>2</sup> flasks. 0.9 million cells were seeded in 30ml medium per flask. Transfections were done as described [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection above]. <br />
:'''Harvesting'''<br />
To harvest the cells, cell suspension was decanted into 500ml corning conical centrifuge tubes. Remaining cells were washed with 19ml PBS and also transferred into the tubes. Cells were collected by centrifugation at 1500rpm for 15min at 4°C. Supernatant was aspirated, cells resuspended in 10ml 1xPBS and transferred into a 50ml blue-cap vial. Centrifugaion as above, aspiration of supernatant. Pellet was then resuspended in 5ml virus lysate solution and frozen at -196°C in liquid nitrogen for 5min, then thawed at 37°C. This freeze/thaw cycle was repeated five times.<br />
:'''Purification'''<br />
Each sample was sonicated in a sonication bath for 1min 20s, 50µg/ml benzonase was added. Samples were kept at 37°C for 30min and vortexed every 10min. Centrifugation for 15min at 3270g, 4°C. Supernatant was transferred in to a new blue cap vial with a 5ml pipette. Gradiant was poured in a Beckman Quick-Seal centrifuge tube and a pasteur pipette plugged into the tube. 5ml of the virus suspension was transferred through the Pasteur pipette into the tube. 1.5ml 15% Iodixanolsolution (in PBS-MK) was poured through the Pasteur pipette in a way thet it presses put the virus suspension. In the same manner, 1.5ml 25% Iodixanolsolution was pipette to become the lower phase, then 1.5ml 40% Iodixanolsolution and finally 1.5ml 60% Iodixanolsolution. The Pasteur pipette was reomeved and the tubes sealed with tube sealer. Ultracentrifulation for 2h at 50.000rpm, 4°C and 71,1 Ti. The virus was recovered from the 40% Iodixanol phase.<br />
<br />
Seeding medium: DMEM high glucose, 10% FCS, 1% P/S, 1% L-Glutamin<br />
Virus lysate solution<br />
PBS-MK: 1xPBS, 1mM MgCl<sub>2</sub>, 2.5mM KCl<br />
Iodixanolsolution<br />
<br />
<br />
=== Quantitative Realtime PCR ===<br />
<br />
To quantitavely measure the amount of AAV rep gene, viruses had to be lysed. First, 10µl TE buffer was mixed with 10µl AAV solution. 20µl 2M NaOH were added and incubated for 30min at 56°C to lyse the viruses. Then 38µl 1M HCl and 922µl H<sub>2</sub>O were added. For a negative control, the same procedure was done with 10µl H<sub>2</sub>O instead of virus. <br />
<br />
For each probe, a 35µl mix of RNase free water, 1x SensiMix II Probe PCR Master Mix, 100pmol/µl forward and reverse primer and 100pm/µl probe was prepared in RNase free water. This was enough for measurement triplicates. To make a RT-PCR standard curve, the standard probes were diluted to concentrations of 3.5x10<sup>11</sup> to 3.5x10<sup>3</sup> molecules in 10µl. <br />
<br />
Thermocycler program was 10min at 95°C initial activation, followed by 40 cycles of 10s at 95°C and 20s at 60°C. <br />
<br />
To find out the concentration of viral genomes per ml (<font face="Symbol">Y</font>) the value of the <font face="Symbol">X</font> position on the standard curve has to be multiplied as follows: <font face="Symbol">Y</font> = <font face="Symbol">X</font> &times;10&sup2; &times;10&sup2;<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
== Measurements ==<br />
=== ELISA ===<br />
==== Procedure ====<br />
# Coating<br />
#* dilute 1st antibody 1<nowiki>:</nowiki>1000 in coating buffer<br />
#* add 50 µl per well<br />
#* incubate over night at 4°C<br />
# Blocking<br />
#* wash three times with 300 µl wash buffer per well<br />
#* add 200 µl blocking buffer per well<br />
#* incubate more than 1 hour at room temperature<br />
#** alternative: over-night at 4°C or freezing at -20°C<br />
# Sample Loading<br />
#* 50 µl per well<br />
#* incubate 2 hours at 37°C<br />
#* wash five times<br />
# Detection<br />
#* dilute 2nd antibody 1:1000 in dilution buffer<br />
#* add 100 µl per well<br />
#* incubate 1 hour at 37°C<br />
#* wash five times<br />
#* add 100 µl substrate per well<br />
#* incubate at room temperature for 5 - 10 min<br />
#* stop with 100µl 2M H<sub>2</sub>SO<sub>4</sub> per well<br />
#* read absorbance at 450 nm wavelength<br />
<br><br />
==== Buffers ====<br />
*'''Coating Buffer''' (0.1M NaHCO<sub>3</sub>, 0.1M Na<sub>2</sub>CO<sub>3</sub>, pH 9.5) <br />
<br />
*'''Diluting/Blocking Buffer (db)''' (0.25 ml Tween 20, 30 g BSA, add 1x PBS to 500 ml)<br />
<br />
*'''Wash Buffer''' (0.5 ml Tween 20, 1L PBS 1x)<br />
<br />
<br />
:'''Calibration'''<br />
* 960 µl db + 40 µl pooled plasma = 200 ng/ml<br />
* add 500 µl of above into 500 µl of db = 100 ng/ml<br />
* serial dilutions continued down to 1.5625 ng/ml<br />
<br />
<br />
:'''Detection reagents'''<br />
* TMB Substrate Kit (Pierce, Thermo Scientific)<br />
* 2M H<sub>2</sub>SO<sub>4</sub><br />
<br><br />
<br />
=== Microscopy ===<br />
<br />
We used microscopy to measure EGFP and EBFP2 fluorescence intensity. Fluorescence was first evaluated using the Leica DM IRB epifluorescence microscope. Only cells which were transfected successfully were measured. First, the cells were washed with 1x PBS and detached from the plate using trypsin. 30µl trypsin was added to each well, incubated for ten minutes at room temperature. Cells were resuspended in 170µl 1%BSA in PBS and replicates for each condition were pooled into 8-well coverslip chambers. 100-150µl were used for confocal microscopy. <br />
<br />
Single cell images were obtained using a Leica TCS SP5 laser scanning confocal microscope (LSCM) and alternatively a Leica TCS SP2 LSCM. EGFP fluorescence was excited by the 488nm laserline of an Argon laser and measured between 520 and 560nm, EBFP2 proteins were excited by UV laser at 405nm and measured between 440 and 460nm. Pictures were taken sequentially line by line in two different channels for EGFP, EBFP2. Bright field was acquired at the same time as the EBFP2 signal from the 405nm laser. <br />
<br />
<br />
[[Image:panel.jpg|thumb|400px|center|'''HeLa cells two days after transfection with miMeasure''' (A) fluorescence signal GFP channel, 8bit; (B) fluorescence signal BFP channel, 8bit; (C) merge of channels A and B, RGB (D) cells after segmentation and automated cell counting and annotation]]<br />
<br />
To analyze the fluorescence of single cells, we segmented the images using ImageJ. In 8bit pictures, we set the threshold for each channel to 50, thereby filtering the background. This allowed us to annotate cells automatically using the “analyze particles” tool. Then we were able to get the fluorescence intensity for each single cell on each channel (EGFP or EBFP2) as an 8bit output, i.e. a value between 50 and 255. Panel 1 shows an example of one such image in different channels and after segmentation. From the data thus obtained, we calculated the EGFP:EBFP2 ratios for each cell using a simple algorithm. This enables us to visualize the mean of these ratios in a bar plot or to use all the data for linear regression curve calculation.<br />
<br />
* Consumables and Chemicals<br />
PerkinElmer ViewPlate, product number: 6004920<br><br />
Nunc Lab-Tek coverglass chamber, product number: 155411<br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4)<br><br />
0.05% Trypsin-EDTA, Invitrogen GIBCO, product number: 15400054<br><br />
<br />
* Instruments<br />
Leica DM IRB<br><br />
Leica SP5<br><br />
Leica SP2<br><br />
ImageJ version 1.43<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br />
<br />
=== Flow cytometry ===<br />
<br />
We used flow cytometry to analyse the EGFP and EBFP2 fluorescence intensities. Cells grown in a 96 well plate were washed once with 1xPBS and then trypsinised. Afterwards they were resuspended in PBS + 1% BSA and analyzed. EGFP and EBFP2 cellular intensities were measured with a flow cytometer was performed equipped with two laser diodes, one at 405nm and one at 488nm. The fluorescence of EGFP and EBFP2 was separated at 495nm by a dichroic mirror. Each signal was filtered through two emission filters: the first with the band pass between 425nm and 475nm to detect EBFP2, the second between 497.5nm and 522.5nm to detect EGFP. The bleed through was compensated by measuring cells only expressing EGFP and accordingly EBFP2. For the measurements 100µl cells in PBS + 1% BSA were pumped by the machine and about 10000 cells were analysed for each construct.<br />
<br />
<br />
* Consumables and Chemicals<br />
Falcon Becton Dickinson Microtest 96, product number: 353072 <br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4) <br><br />
Bovine Serum Albumine, Sigma, product number: A9647 <br><br />
<br />
<br />
* Instruments<br />
Beckman Coulter Cytomics FC500MPL<br />
<br />
<br />
*Analysis<br />
The reduction of EGFP expression compared to EBFP2 that we observed by flow cytometry could be quantitated as follow: two-dimensional scatter count plots representing cell counts for each EBFP2-EGFP intensity pair on a linear scale were exported as 64X64 pixel images. To ignore non-transfected cells, a square of 3X3 pixel originating from (0,0), where control non-transfected cells accumulate, was put to zero in each count plot. A ratio image of the same size containing the EGFP-EBFP2 intensity ratio for each pixel was generated. The mean ratio was estimated by multiplying each count plot with the ratio image, measuring the total image intensity and dividing it by the total count of each count plot. For the standard deviation, the mean intensity of a count plot was subtracted to the ratio image. the square of each pixel intensity was multiplied by the corresponding count and the total intensity of the result was divided by the total count. The standard deviation was then calculated by taking the square root of this number. All steps were performed on imageJ. <br />
<br />
<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
=== Dual Luciferase Assay ===<br />
We measured the knockdown of firefly luciferase using the [http://www.promega.com/tbs/tm046/tm046.pdf Promega Dual Luciferase Reporter Assay]. <br />
The DLR™ Assay System provides an efficient mean of performing dual-reporter assays, where the activities of firefly (<i>Photinus pyralis</i>) and Renilla (<i>Renilla reniformis</i>) luciferases (RL) are measured sequentially from a single sample. Firefly and Renilla luciferases can be used as a good reporter system, as those two enzymes have dissimilar enzyme structures and substrate requirements. This allows for selective discrimination between their bioluminescent reactions. The firefly luciferase (FL) reporter is measured first by adding Luciferase Assay Reagent II (LAR II) to generate a stabilized luminescent signal. After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is simultaneously initiated by adding Stop & Glo® Reagent to the same tube. The Stop & Glo® Reagent also produces a stabilized signal from the Renilla luciferase, which decays slowly over the course of the measurement. Here, Renilla luciferase is used for normalization. The measurements were conducted on the Promega GLOMAX 96 Microplate Luminometer using the Promega standard protocol ([https://2010.igem.org/Team:Heidelberg/Project/References#Materials_and_Methods Sherf et al., 1996]). <br><br />
Twenty hours after transfection, cells were washed with 1x PBS and lysed using 1x Passive Lysis Buffer (5x stock solution diluted with distilled water), shaking for 30 minutes at 37°C. 10µl of the lysate were transferred to a white microplate (LumaPlate) as required for Luminometer measurements. <br />
<br />
LAR II reagent was prepared by resuspending Luciferase Assay Substrate in 10ml Luciferase Assay Buffer II. For Stop & Glo reagent, 2.1ml 50x Stop & Glo substrate and 105ml Stop & Glo Buffer were added to the amber Stop & Glo reagent bottle and mixed by vortexing. Reagents where stored in 15ml aliquots at -80°C and thawed freshly prior to each measurement.<br />
<br />
To set up the Luminometer, the two injectors where flushed with distilled water, 70% ethanol, again water and air, three times each. Afterwards, they were primed three times with substrate reagents. <br />
<br />
The activity of the first luciferase (firefly) was measured by adding 25µl of LAR II reagent to the well. The enzyme reacts upon translation without further processing and oxidates beetle luciferin, resulting in photon emission that can be measured. In addition to beetle luciferin, the LAR II reagent contains coenzyme A, which accelerates the reaction and thus creates a prolonged luminescence signal. The luminescence was measured two seconds after addition of the reagent, for ten seconds. Afterwards, 25µl Stop & Glo reagent was added, which is able to quench the firefly luciferase activity and simultaneously contains the substrate for Renilla luciferase, coelenterazine. This second reaction also emits photons upon oxidation of the substrate. Addition of substrates and light emission measurements were conducted automatically by the GLOMAX Luminometer.<br />
<br><br />
==== Order of recording and processing raw data ====<br />
# triple-transfection of the following constructs in ratio 10:1:1<br />
#* shRNA-like miRNA (shRNA miR) expressing plasmid (25 ng / well)<br />
#* reference construct containing hRluc (2.5 ng / well)<br />
#* tuning construct with Luc2 fused to binding site referring to shRNA miR (2.5 ng / well)<br />
#: note: used backbones for all constructs were either pBS_U6 or pBS_H1<br />
# measurement of bioluminescent signal after substrate addition<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_date_samples_ctrl_BB.xls<br />
## first injection: LARII<br />
##* quantification of Firefly signal<br />
## second injection: Stop & Glo® Reagent<br />
##* quantification of Renilla signal<br />
# calculate signal ratio: Firefly/Renilla<br />
#: note: Renilla is used as a reference, Firefly signal determines binding site strength<br />
#* controls on every plate: perfect binding site (lower expression limit), no binding site (upper expression limit = 100%) defining overall expression range<br />
#* another control: separate triple-transfections of tuning constructs with a shRNA miR expression plasmid that is ''not'' corresponding to the binding site on the tuning construct (upper expression limit)<br />
# normalization by control without binding site<br />
#* thus, normalized value corresponds to knockdown percentage<br />
# deviation of knockdown percentage for corresponding shRNA miR by referring knockdown percentage of non-corresponding shRNA miR<br />
# calculate mean values and standard deviation (out of eight replicates) for each construct containing imperfect binding site (intermediate expression)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: plate#_process_BB_shRNA.xls<br />
#* note: error propagation has to be taken into account<br />
# grade calculated knockdown percentages in ascending order (lowest value always for perfect binding site, whereas maximum value without binding site)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_BB_final.xlsx<br />
<br/><br />
===== nomenclature =====<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|'''table 1''': Used nomenclature for raw data files.<br />
| abbreviation||meaning||example<br />
|-<br />
|shRNA||expressed shRNA miR||shRNA miR against hAAT ("hAAT")<br />
|-<br />
|date||date of measurement in format YYYYMMDD||20101026<br />
|-<br />
|samples||internal ID of constructs||M1-M6<br />
|-<br />
|BB||plasmid backbone||either pBS_U6 ("U6") or pBS_H1 ("H1")<br />
|-<br />
|plate#||number of measured 96 well plate||plate1<br />
|-<br />
|}<br />
<br/><br />
<br />
==== Consumables and Reagents ====<br />
LumaPlate, PerkinElmer, catalogue number 6005630<br><br />
[http://www.promega.com/tbs/tm046/tm046.pdf, Promega Dual-Luciferase® Reporter Assay System], catalogue number E1910<br />
<br><br />
<br />
==== Instruments ====<br />
Promega GLOMAX 96 Microplate Luminometer<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T22:31:06Z<p>Kleinsorg: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#30.2F10.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#31.2F10.2F2010 31]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
To create binding site (BS) patterns for micro RNAs (miRNAs) , we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team ([https://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters#RA-PCR_protocol see here]) and adopted it to our purposes.<br />
The differences:<br />
*Sequences from 100 to 400 base pairs are requested.<br />
*Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) BS recognition<br />
:*distance and sequence between miRBS (the spacer)<br />
<br />
<br />
See on our Notebook pages how we created binding site patterns.<br />
<br />
The adopted method for BS-patterns can be found on our [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#random_assembly_PCR methods page].<br />
<br />
On the [https://2010.igem.org/Team:Heidelberg/Parts#synthetic_microRNA_binding_Site_patterns_against_endogenous_miRNA Parts]-Page you can find standardized BS-patterns for hsa-mir-122 and has-mir-221, containing at least 2 binding sites.<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T22:29:03Z<p>Kleinsorg: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#30.2F10.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#31.2F10.2F2010 31]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
To create binding site (BS) patterns for micro RNAs (miRNAs) , we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team ([https://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters#RA-PCR_protocol see here]) and adopted it to our purposes.<br />
The differences:<br />
*Sequences from 100 to 400 base pairs are requested.<br />
*Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) BS recognition<br />
:*distance and sequence between miRBS (the spacer)<br />
<br />
<br />
See on our Notebook pages how we created binding site patterns.<br />
<br />
The adopted method for BS-patterns can be found on our [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#random_assembly_PCR methods page].<br />
<br />
On the [synthetic_microRNA_binding_Site_patterns_against_endogenous_miRNA Parts]-Page you can find standardized BS-patterns for hsa-mir-122 and has-mir-221, containing at least 2 binding sites.<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T22:26:41Z<p>Kleinsorg: /* synthetic microRNA binding Site patterns against endogenous miR122 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks - Parts submitted to the registry=<br />
<br><br />
<br />
The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels. <br />
<br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.<br />
<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==synthetic microRNA binding Site patterns against endogenous miRNA==<br />
<center><br />
<br />
<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==miTuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
==ViroBytes==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=150px|Part name||width=100px|Registry link||width=300px|Description<br />
|-<br />
|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites at both ends<br />
|-<br />
|2 ||Fragment 2 of wt AAV1||[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]||flanked with Bsa1 sites at both ends<br />
|-<br />
|3 ||Fragment 3 of wt AAV1||[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]||flanked with Bsa1 sites at both ends<br />
|-<br />
|4 ||Fragment 4 of wt AAV1||[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]||flanked with Bsa1 sites at both ends<br />
|-<br />
|5 ||Fragment 5 of wt AAV1||[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]||flanked with Bsa1 sites at both ends<br />
|-<br />
|6 ||Fragment 6 of wt AAV1||[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]||flanked with Bsa1 sites at both ends<br />
|-<br />
|7 ||Fragment 7 of wt AAV1||[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]||flanked with Bsa1 sites at both ends<br />
|-<br />
|8 ||Fragment 8 of wt AAV1||[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]||flanked with Bsa1 sites at both ends<br />
|-<br />
|9 ||Fragment 1 of wt AAV2||[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]||flanked with Bsa1 sites at both ends<br />
|-<br />
|10 ||Fragment 2 of wt AAV2||[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]||flanked with Bsa1 sites at both ends<br />
|-<br />
|11 ||Fragment 3 of wt AAV2||[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]||flanked with Bsa1 sites at both ends<br />
|-<br />
|12 ||Fragment 4 of wt AAV2||[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]||flanked with Bsa1 sites at both ends<br />
|-<br />
|13 ||Fragment 5 of wt AAV2||[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]||flanked with Bsa1 sites at both ends<br />
|-<br />
|14 ||Fragment 6 of wt AAV2||[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]||flanked with Bsa1 sites at both ends<br />
|-<br />
|15 ||Fragment 7 of wt AAV2||[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]||flanked with Bsa1 sites at both ends<br />
|-<br />
|16 ||Fragment 8 of wt AAV2||[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]||flanked with Bsa1 sites at both ends<br />
|-<br />
|17 ||Fragment 1 of wt AAV5||[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]||flanked with Bsa1 sites at both ends<br />
|-<br />
|18 ||Fragment 2 of wt AAV5||[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]||flanked with Bsa1 sites at both ends<br />
|-<br />
|19 ||Fragment 3 of wt AAV5||[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]||flanked with Bsa1 sites at both ends<br />
|-<br />
|20 ||Fragment 4 of wt AAV5||[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]||flanked with Bsa1 sites at both ends<br />
|-<br />
|21 ||Fragment 5 of wt AAV5||[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]||flanked with Bsa1 sites at both ends<br />
|-<br />
|22 ||Fragment 6 of wt AAV5||[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]||flanked with Bsa1 sites at both ends<br />
|-<br />
|23 ||Fragment 7 of wt AAV5||[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]||flanked with Bsa1 sites at both ends<br />
|-<br />
|24 ||Fragment 8 of wt AAV5||[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]||flanked with Bsa1 sites at both ends<br />
|-<br />
|25 ||Fragment 1 of wt AAV6||[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]||flanked with Bsa1 sites at both ends<br />
|-<br />
|26 ||Fragment 2 of wt AAV6||[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]||flanked with Bsa1 sites at both ends<br />
|-<br />
|27 ||Fragment 3 of wt AAV6||[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]||flanked with Bsa1 sites at both ends<br />
|-<br />
|28 ||Fragment 4 of wt AAV6||[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]||flanked with Bsa1 sites at both ends<br />
|-<br />
|29 ||Fragment 5 of wt AAV6||[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]||flanked with Bsa1 sites at both ends<br />
|-<br />
|30 ||Fragment 6 of wt AAV6||[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]||flanked with Bsa1 sites at both ends<br />
|-<br />
|31 ||Fragment 7 of wt AAV6||[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]||flanked with Bsa1 sites at both ends<br />
|-<br />
|32 ||Fragment 8 of wt AAV6||[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]||flanked with Bsa1 sites at both ends<br />
|-<br />
|33 ||Fragment 1 of wt AAV8||[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]||flanked with Bsa1 sites at both ends<br />
|-<br />
|34 ||Fragment 2 of wt AAV8||[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]||flanked with Bsa1 sites at both ends<br />
|-<br />
|35 ||Fragment 3 of wt AAV8||[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]||flanked with Bsa1 sites at both ends<br />
|-<br />
|36 ||Fragment 4 of wt AAV8||[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]||flanked with Bsa1 sites at both ends<br />
|-<br />
|37 ||Fragment 5 of wt AAV8||[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]||flanked with Bsa1 sites at both ends<br />
|-<br />
|38 ||Fragment 6 of wt AAV8||[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]||flanked with Bsa1 sites at both ends<br />
|-<br />
|39 ||Fragment 7 of wt AAV8||[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]||flanked with Bsa1 sites at both ends<br />
|-<br />
|40 ||Fragment 8 of wt AAV8||[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]||flanked with Bsa1 sites at both ends<br />
|-<br />
|41 ||Fragment 1 of wt AAV9||[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]||flanked with Bsa1 sites at both ends<br />
|-<br />
|42 ||Fragment 2 of wt AAV9||[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]||flanked with Bsa1 sites at both ends<br />
|-<br />
|43 ||Fragment 3 of wt AAV9||[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]||flanked with Bsa1 sites at both ends<br />
|-<br />
|44 ||Fragment 4 of wt AAV9||[http://partsregistry.org/Part:BBa_K337101 BBa_K337101]||flanked with Bsa1 sites at both ends<br />
|-<br />
|45 ||Fragment 5 of wt AAV9||[http://partsregistry.org/Part:BBa_K337102 BBa_K337102]||flanked with Bsa1 sites at both ends<br />
|-<br />
|46 ||Fragment 6 of wt AAV9||[http://partsregistry.org/Part:BBa_K337103 BBa_K337103]||flanked with Bsa1 sites at both ends<br />
|-<br />
|47 ||Fragment 7 of wt AAV9||[http://partsregistry.org/Part:BBa_K337104 BBa_K337104]||flanked with Bsa1 sites at both ends<br />
|-<br />
|48 ||Fragment 8 of wt AAV9||[http://partsregistry.org/Part:BBa_K337105 BBa_K337105]||flanked with Bsa1 sites at both ends<br />
|-<br />
<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/User:KleinsorgUser:Kleinsorg2010-10-27T22:23:13Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Template}}<br />
<br />
<html><br />
<style type="text/css"><br />
<br />
.profile img {<br />
float:left;<br />
}<br />
<br />
.profile a.member {<br />
cursor:default;<br />
display:block;<br />
text-decoration:none;<br />
float:left;<br />
}<br />
<br />
.t3 {<br />
text-align:right;<br />
}<br />
<br />
.profile a.member {<br />
background-repeat:no-repeat;<br />
background-position:0 7px;<br />
}<br />
<br />
.link_r {padding-right:23px;}<br />
<br />
</style><br />
</html><br />
<br />
{{:Team:Heidelberg/Pagetop}}<br />
<br />
<html><br />
<table style="font-size:1.1em; font-weight:bold; width:620px; border: none; padding:0px; margin-left:0px;" cellpadding="0" cellspacing="0" id="support_navi"><br />
<tr><br />
<td class="link_l"><a href="#Students">Students</a></td><br />
<td class="link_r">&nbsp;</td><br />
<td class="link_l"><a href="#Instructors">Instructors</a></td><br />
<td class="link_r">&nbsp;</td><br />
<td class="link_l"><a href="#Advisors">Advisors</a></td><br />
<td class="link_r">&nbsp;</td><br />
<td style="width:320px;">&nbsp;</td><br />
</tr><br />
</table><br />
<br />
<br><br />
<br />
<div class="t2"><a name="Students" href="#Students">Students</a></div><br />
</html><br />
<br />
<br />
Test: <br />
<partinfo>BBa_B0015</partinfo><br />
<br />
[[User:Kleinsorg/test]]<br />
<br />
[[User:Kleinsorg/menu]]<br />
<br />
{{FULLURL:{{SUBJECTPAGENAMEE}}}}<br />
<br />
{{:Team:Heidelberg/ref|2}}<br />
This is a test to try, if {{HDref|der da}} really works.<br />
<br />
<groupparts>iGEM2010 Heidelberg</groupparts><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html> <br />
<br />
{{toparrow}}<br />
<br />
==References==<br />
<br />
[1] refs<br/><br />
[2] refs<br/><br />
[3] refs<br/><br />
[4] refs<br/><br />
[5] refs<br/><br />
[6] refs<br/><br />
[7] refs<br/><br />
[8] refs<br/><br />
[9] refs<br/><br />
[10] refs<br/><br />
[11] refs<br/><br />
[12] refs<br/><br />
[13] refs<br/><br />
[14] refs<br/><br />
[15] refs<br/><br />
[16] refs<br/><br />
[17] refs<br/><br />
[18] refs<br/><br />
[19] refs<br/><br />
[20] refs<br/><br />
[21] refs<br/><br />
[22] refs<br/><br />
[23] refs<br/><br />
[24] refs<br/><br />
[25] refs<br/><br />
[26] refs<br/><br />
[27] refs<br/><br />
[28] refs<br/><br />
[29] refs<br/><br />
[30] refs<br/><br />
[31] refs<br/><br />
[32] refs<br/><br />
[33] refs<br/><br />
[34] refs<br/><br />
[35] refs<br/><br />
[36] refs<br/><br />
[37] refs<br/><br />
[38] refs<br/><br />
[39] refs<br/><br />
[40] refs<br/><br />
[41] refs<br/><br />
[42] refs<br/><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
{{:Team:Heidelberg/Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/MethodsTeam:Heidelberg/Notebook/Methods2010-10-27T22:19:19Z<p>Kleinsorg: /* Cloning */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_methods}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Methods=<br />
==Cloning==<br />
<br />
===Agarose Gel Electrophoresis===<br />
Agarose flat-bed gels in various concentrations (0.6–2% agarose in 0.5 x TAE buffer) and sizes were run to separate DNA fragments in an electrical field (10–20 V/cm) for analytical or preparative use. The desired amount of agarose was boiled in 1 x TAE buffer until it was completely dissolved. After it cooled down to approximately 60°C, ethidium bromide (EtBr) solution (0.5 µg/ml final concentration) was added to the liquid agar, which was then poured in a flat-bed tray with combs. As soon as the agarose solidified, the Running buffer (0.5 x TAE buffer) was added before the DNA in the loading buffer was loaded into the wells and separated electrophoretically. Ethidium bromide intercalates with the DNA’s GC ntss resulting in DNA-EtBr-complex that emits visible light. Therefore, the DNA fragments could be detected on a UV-light tray at 265 nm.<br />
<br><br><br />
<br />
===Colony PCR===<br />
<br />
Colony PCRs were performed using Fermentas PCR Master Mix (2x), containing ''Taq'' DNA Polymerase.<br/><br />
Bacterial colonies were picked form an LB/Agar-plate and either resuspended in PCR reaction mix and subsequently used to inoculate LB-medium with appropriate antibiotic, or resuspended in water. The water was then taken as "template" for PCR and inoculation of Minepreps.<br/><br />
The PCR was performed using 20 pmol of forward and reverse primer (= 0.2 µL of 100µM) in a total volume of 20&nbsp;µL.<br/><br />
PCR conditions were set to recommendations made by Fermentas:<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|95°||03:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|94°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 30 cycles<br />
|-<br />
|45°'''*'''||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|01:00 /kb<br />
|-<br />
|72°||10:00||<br />
|-<br />
|4°||8||<br />
|}<br />
<br><br><br />
<br />
'''*'''with 45°C at a minimum of primer annealing temp<br />
<br />
===Plasmid-PCR===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|02:30<br />
|-<br />
|72°||10:00||<br />
|}<br />
<br />
===shRNA-PCR protocol===<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
<br />
!Temp !! Time !!<br />
|-<br />
|98°||00:30||<br />
|-<br />
|style="border-top:solid 1px #000000;"|98°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:10||rowspan="3"|x 35 cycles<br />
|-<br />
|60°||style="border-right:solid 1px #000000;"|00:30<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:15<br />
|-<br />
|72°||1:00||<br />
|-<br />
|4°||forever||<br />
|}<br />
<br />
===Gel extraction===<br />
After gel electrophoresis the digested vector and insert have to be purified from the gel. With the help of a UV lamp, the bands were quickly excised from the gel without exposing the DNA too long to UV light. Afterwards the DNA was purified with the QIAquick Gel extraction kit. Three volumes of buffer QG were added to one volume of gel. The gel fragment was dissolved by incubation for 10 min at 50°C. Afterwards one volume of 100% isopropanol was added. The solution was applied on a QIAquick spin column after this has been placed into a provided 2 ml collection tube. By centrifugation for 1 min at 13.000 rpm the DNA was bound to the column. The flow-through was discarded and the column was placed in the same collection tube. To remove all traces of agarose from the column, 500 µl of wash buffer QC was added followed by centrifugation for 1 min at 13.000 rpm. The flow-through was discarded and the column was washed with 750 µl of buffer PE for 1 min at 13.000 rpm. Afterwards the flow-through was discarded. An additional centrifugation for 1 min at 13.000 rpm helped to remove the residual ethanol. The column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 30 µl of ddH2O.<br />
<br><br><br />
<br />
===Large scale preparation of plasmid DNA===<br />
150 ml LB-Medium with 150 µl ampicillin was inoculated with 50 µl of bacteria culture which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin MAxiprep kit from Qiagen and the protocol was followed. The overnight culture was centrifuged for 20 min at 4000 rpm at 4°C using an SLA 1500 Rotor. Afterwards the LB-medium was discarded and the pellet was homogeneously resuspended in 10 ml of precooled Buffer P1. After having added 10 ml of Buffer P2 the mixture was inverted 4-6 times and incubated for 5 min at RT before adding 10 ml of chilled Buffer P3. Thereafter the lysate was poured into a prepared QIAfilter Maxi Cartridge and incubated at RT for 10 min. During this time a QIAGEN-tip 500 was equilibrated by applying 10 ml of Buffer QBT and allowing the column to empty by gravity flow. The cell lysate was filtered into the QIAGEN-tip. The cleared lysate entered the resin by gravity flow and after washing with 2 x 30 ml Buffer QC the Plasmid DNA was eluted with 15 ml Buffer QF. After this the DNA was precipitated by adding 10.5 ml isopropanol and centrifuged at 4,000 rpm for 45 min at 4°C. The supernatant was discarded and the DNA pellet was washed with 5 ml ethanol (70%) and centrifuged at 4,000 rpm for 15 min. After air-drying the pellet the DNA was redissolved in H2O. <br><br />
<br><br />
<br />
===Plasmid-DNA isolation===<br />
5 ml LB-Medium with 5 µl ampicillin was inoculated with single colonies which grew overnight on a shaker at 37°C. The plasmid DNA was isolated using QiAprep Spin Miniprep kit from Qiagen and following the manufacturer’s protocol. 4 ml of each overnight culture was pelleted in 2 ml microcentrifuge tubes during two steps of centrifugation at 13.000 rpm. Subsequently the pellet was resuspended in 250 µl of chilled buffer P1. 250 µl of lysis buffer P2 was added and the solution was mixed thoroughly by inverting the tube 4-6 times. After adding 350 µl of the neutralization Buffer N3 the solution was mixed immediately and thoroughly by inverting the tube 4-6 times. Thereafter the mixture was centrifuged. The supernatants were applied to a QIAprep column which was put in a 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. After adding 500 µl of wash buffer PB, it was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded. Once more, it was washed with 750 µl of wash buffer PE. In an additional centrifugation for 1 min at 13.000 rpm the residual wash buffer was removed. The QIAprep column was placed into a clean 1.5 ml microcentrifuge tube and the plasmid DNA was eluted in 30 µl ddH2O.<br />
<br><br><br />
<br />
===Preparation of competent E. coli Top10 and DH5alpha===<br />
Plating of E. coli Top10 and DH5alpha on a agar plate (LB, without Amp); Preperation of competent cells according to the following protocol:<br />
<br />
First, a 20 ml over night culture was inoculated in antibiotic free LB medium from a fresh single colony and transferred into 400 ml antibiotic free LB medium the next day. This culture was incubated at 37 °C while shacking until an OD600 of 0.5 – 0.6 was achieved. The culture was than cooled down on ice, centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded and the pellet resuspended in 10 ml 100 mM CaCl2. After addition of further 190 ml 100 mM CaCl2 the suspension was incubated on ice for 30 min. The suspension was than again centrifuged (8 min, 4 °C, 3500 rpm), the supernatant discarded, the pellet resuspended in 20 ml 82.5 mM CaCl2 with 17.5 % glycerol and aliquoted. The aliquots were flash frozen in liquid nitrogen and than stored at -80 °C until usage.<br />
<br /><br /><br />
<br />
===Purification of PCR product===<br />
One volume of buffer PBI was added to one volume of the PCR sample mix. The sample was applied to a QIAquick column which has been placed into a provided 2 ml collection tube. It was centrifuged for 1 min at 13.000 rpm and the flow-through was discarded and the column was placed in the same collection tube. After this 750 µl of buffer PE was added to wash the column. It was centrifuged for 1 min at 13.000 rpm. The flow-through was discarded and the column was placed in the same collection tube. It was centrifuged for 1 min at 13.000 rpm. Afterwards the QIAquick column was placed into a new 1.5 ml microcentrifuge tube and it was eluted with 40 µl ddH2O.<br />
<br><br><br />
<br />
<br />
=== random assembly PCR ===<br />
<br />
<br><br><br />
<br />
===Sequencing===<br />
Performed by the GATC Biotech company<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br><br />
<br />
==Cell culture==<br />
===Media===<br />
*HeLa - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK293T - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*HEK T-REx - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 50µg/ml Zeocin<br />
*HEK T-REx (with pcDNA5 integrated) - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 50µg/ml Blasticidin, 100µg/ml Hygromycin<br />
*Huh7 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 1% Non-essential amino acids<br />
*HepG2 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*Hepa1.6 - DMEM, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin<br />
*primary hepatocytes - William's Medium E, 10% Fetal Bovine Serum, 100 unit Penicillin, 100 µg/ml Streptomycin, 2mM L-Glutamin, 100nM Dexamethasone<br />
<br><br />
<br />
===Passaging===<br />
*remove media<br />
*wash cells one time in PBS (10ml)<br />
*remove PBS; add 2 ml of trypsin-EDTA solution and incubate cells for 5 min at 37 °C<br />
*add 5 ml of the according media<br />
*take 1/10th of the cell suspension and plate out on the according dish (either p100 dish, 6 well plate or T-flask)<br />
<br><br />
<br />
===Thawing===<br />
Thawing of Huh-7, HeLa p4 and HEK-293 cells according to the following protocol<br />
vials from liquid nitrogen were thawn at 37 °C<br />
once, the probe was nearly completely thawn, cells were thrown into pre-warmed DMEM (10 % FCS, L-Glut, P/S) and gentely mixed<br />
cells were spinned down at 800 rpm, 3 min; supernatant was discarded<br />
the pellett was resuspended in 10 ml DMEM an plated on a p100 cell culture dish in the following media according to the different cell lines:<br />
<br />
===Coating===<br />
For 96-well plates:<br />
*add 30 µl of poly-L-lysine solution (Sigma) to each well (make sure whole surface is covered with solution)<br />
*leave for 30' in the incubator<br />
*remove poly-L-lysine solution<br />
*wash once with 1x PBS<br />
<br><br />
<br />
===Transfection===<br />
====FuGENE====<br />
DAY1<br />
*seed cells<br />
DAY2 <br />
*transfection<br />
**to media (OptiMEM, no FBS) add [http://www.roche-applied-science.com/pack-insert/1815091a.pdf FuGENE 6 reagent] (it is important to add FuGENE to media, not other way round and not to drop FuGENE on the walls of the tube)<br />
**incubate 5 minutes at room temperature<br />
**add DNA<br />
**incubate 15 minutes<br />
**mix well and add dropwise to the well<br />
<br/><br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc<br />
!culture format!!number of cells seeded!!volume of culture media!!amount of DNA!!volume of FuGENE!!volume of media for FuGENE activation<br />
|-<br />
|96-well||5 000||100µl||50ng||0.3µl||5µl<br />
|-<br />
|24-well||30 000||500µl||200ng||0.6µl||20µl<br />
|-<br />
|6-well||100 000||2500µl||1000ng||3µl||100µl<br />
|-<br />
|labtec chamber||10 000||400µl||200ng||0.4µl||20µl<br />
|-<br />
|}<br />
<br />
<br/><br />
====PEI====<br />
150cm<sup>2</sup> plate format<br />
*mixture 1:<br />
**44ug DNA<br />
**up to 790µl of H2O each flask<br />
**add 790µl of 300mM NaCl<br />
*mixture 2:<br />
**343µl of PEI<br />
**790µl of 300mM NaCl<br />
**add mixture 2 to mixture 1<br />
**incubate 10 min at RT<br />
**add to cells<br />
<br><br />
<br />
====HBSS====<br />
150cm<sup>2</sup> flask format<br />
*50ugDNA<br />
*2.67ml 250mM CaCl<sub>2</sub><br />
*2.67ml 2x HBSS<br />
<br />
*warm up both CaCl<sub>2</sub> and HBSS<br />
*add plasmid to CaCl<sub>2</sub> solution<br />
*pour 2x HBSS to erlenmeyer flask<br />
*very slowly add CaCl<sub>2</sub> to HBSS, mix vigorously during adding (should become turbid)<br />
*incubate for one minute in the room temperature<br />
*add transfection mix to media (1 volume of mix, 2 volumes of media)<br />
*pour on cells<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
<br />
== Virus Production ==<br />
<br />
:'''Seeding'''<br />
Virus production was done in 150cm<sup>2</sup> flasks. 0.9 million cells were seeded in 30ml medium per flask. Transfections were done as described [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection above]. <br />
:'''Harvesting'''<br />
To harvest the cells, cell suspension was decanted into 500ml corning conical centrifuge tubes. Remaining cells were washed with 19ml PBS and also transferred into the tubes. Cells were collected by centrifugation at 1500rpm for 15min at 4°C. Supernatant was aspirated, cells resuspended in 10ml 1xPBS and transferred into a 50ml blue-cap vial. Centrifugaion as above, aspiration of supernatant. Pellet was then resuspended in 5ml virus lysate solution and frozen at -196°C in liquid nitrogen for 5min, then thawed at 37°C. This freeze/thaw cycle was repeated five times.<br />
:'''Purification'''<br />
Each sample was sonicated in a sonication bath for 1min 20s, 50µg/ml benzonase was added. Samples were kept at 37°C for 30min and vortexed every 10min. Centrifugation for 15min at 3270g, 4°C. Supernatant was transferred in to a new blue cap vial with a 5ml pipette. Gradiant was poured in a Beckman Quick-Seal centrifuge tube and a pasteur pipette plugged into the tube. 5ml of the virus suspension was transferred through the Pasteur pipette into the tube. 1.5ml 15% Iodixanolsolution (in PBS-MK) was poured through the Pasteur pipette in a way thet it presses put the virus suspension. In the same manner, 1.5ml 25% Iodixanolsolution was pipette to become the lower phase, then 1.5ml 40% Iodixanolsolution and finally 1.5ml 60% Iodixanolsolution. The Pasteur pipette was reomeved and the tubes sealed with tube sealer. Ultracentrifulation for 2h at 50.000rpm, 4°C and 71,1 Ti. The virus was recovered from the 40% Iodixanol phase.<br />
<br />
Seeding medium: DMEM high glucose, 10% FCS, 1% P/S, 1% L-Glutamin<br />
Virus lysate solution<br />
PBS-MK: 1xPBS, 1mM MgCl<sub>2</sub>, 2.5mM KCl<br />
Iodixanolsolution<br />
<br />
<br />
=== Quantitative Realtime PCR ===<br />
<br />
To quantitavely measure the amount of AAV rep gene, viruses had to be lysed. First, 10µl TE buffer was mixed with 10µl AAV solution. 20µl 2M NaOH were added and incubated for 30min at 56°C to lyse the viruses. Then 38µl 1M HCl and 922µl H<sub>2</sub>O were added. For a negative control, the same procedure was done with 10µl H<sub>2</sub>O instead of virus. <br />
<br />
For each probe, a 35µl mix of RNase free water, 1x SensiMix II Probe PCR Master Mix, 100pmol/µl forward and reverse primer and 100pm/µl probe was prepared in RNase free water. This was enough for measurement triplicates. To make a RT-PCR standard curve, the standard probes were diluted to concentrations of 3.5x10<sup>11</sup> to 3.5x10<sup>3</sup> molecules in 10µl. <br />
<br />
Thermocycler program was 10min at 95°C initial activation, followed by 40 cycles of 10s at 95°C and 20s at 60°C. <br />
<br />
To find out the concentration of viral genomes per ml (<font face="Symbol">Y</font>) the value of the <font face="Symbol">X</font> position on the standard curve has to be multiplied as follows: <font face="Symbol">Y</font> = <font face="Symbol">X</font> &times;10&sup2; &times;10&sup2;<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br />
== Measurements ==<br />
=== ELISA ===<br />
==== Procedure ====<br />
# Coating<br />
#* dilute 1st antibody 1<nowiki>:</nowiki>1000 in coating buffer<br />
#* add 50 µl per well<br />
#* incubate over night at 4°C<br />
# Blocking<br />
#* wash three times with 300 µl wash buffer per well<br />
#* add 200 µl blocking buffer per well<br />
#* incubate more than 1 hour at room temperature<br />
#** alternative: over-night at 4°C or freezing at -20°C<br />
# Sample Loading<br />
#* 50 µl per well<br />
#* incubate 2 hours at 37°C<br />
#* wash five times<br />
# Detection<br />
#* dilute 2nd antibody 1:1000 in dilution buffer<br />
#* add 100 µl per well<br />
#* incubate 1 hour at 37°C<br />
#* wash five times<br />
#* add 100 µl substrate per well<br />
#* incubate at room temperature for 5 - 10 min<br />
#* stop with 100µl 2M H<sub>2</sub>SO<sub>4</sub> per well<br />
#* read absorbance at 450 nm wavelength<br />
<br><br />
==== Buffers ====<br />
*'''Coating Buffer''' (0.1M NaHCO<sub>3</sub>, 0.1M Na<sub>2</sub>CO<sub>3</sub>, pH 9.5) <br />
<br />
*'''Diluting/Blocking Buffer (db)''' (0.25 ml Tween 20, 30 g BSA, add 1x PBS to 500 ml)<br />
<br />
*'''Wash Buffer''' (0.5 ml Tween 20, 1L PBS 1x)<br />
<br />
<br />
:'''Calibration'''<br />
* 960 µl db + 40 µl pooled plasma = 200 ng/ml<br />
* add 500 µl of above into 500 µl of db = 100 ng/ml<br />
* serial dilutions continued down to 1.5625 ng/ml<br />
<br />
<br />
:'''Detection reagents'''<br />
* TMB Substrate Kit (Pierce, Thermo Scientific)<br />
* 2M H<sub>2</sub>SO<sub>4</sub><br />
<br><br />
<br />
=== Microscopy ===<br />
<br />
We used microscopy to measure EGFP and EBFP2 fluorescence intensity. Fluorescence was first evaluated using the Leica DM IRB epifluorescence microscope. Only cells which were transfected successfully were measured. First, the cells were washed with 1x PBS and detached from the plate using trypsin. 30µl trypsin was added to each well, incubated for ten minutes at room temperature. Cells were resuspended in 170µl 1%BSA in PBS and replicates for each condition were pooled into 8-well coverslip chambers. 100-150µl were used for confocal microscopy. <br />
<br />
Single cell images were obtained using a Leica TCS SP5 laser scanning confocal microscope (LSCM) and alternatively a Leica TCS SP2 LSCM. EGFP fluorescence was excited by the 488nm laserline of an Argon laser and measured between 520 and 560nm, EBFP2 proteins were excited by UV laser at 405nm and measured between 440 and 460nm. Pictures were taken sequentially line by line in two different channels for EGFP, EBFP2. Bright field was acquired at the same time as the EBFP2 signal from the 405nm laser. <br />
<br />
<br />
[[Image:panel.jpg|thumb|400px|center|'''HeLa cells two days after transfection with miMeasure''' (A) fluorescence signal GFP channel, 8bit; (B) fluorescence signal BFP channel, 8bit; (C) merge of channels A and B, RGB (D) cells after segmentation and automated cell counting and annotation]]<br />
<br />
To analyze the fluorescence of single cells, we segmented the images using ImageJ. In 8bit pictures, we set the threshold for each channel to 50, thereby filtering the background. This allowed us to annotate cells automatically using the “analyze particles” tool. Then we were able to get the fluorescence intensity for each single cell on each channel (EGFP or EBFP2) as an 8bit output, i.e. a value between 50 and 255. Panel 1 shows an example of one such image in different channels and after segmentation. From the data thus obtained, we calculated the EGFP:EBFP2 ratios for each cell using a simple algorithm. This enables us to visualize the mean of these ratios in a bar plot or to use all the data for linear regression curve calculation.<br />
<br />
* Consumables and Chemicals<br />
PerkinElmer ViewPlate, product number: 6004920<br><br />
Nunc Lab-Tek coverglass chamber, product number: 155411<br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4)<br><br />
0.05% Trypsin-EDTA, Invitrogen GIBCO, product number: 15400054<br><br />
<br />
* Instruments<br />
Leica DM IRB<br><br />
Leica SP5<br><br />
Leica SP2<br><br />
ImageJ version 1.43<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br><br />
<br />
=== Flow cytometry ===<br />
<br />
We used flow cytometry to analyse the EGFP and EBFP2 fluorescence intensities. Cells grown in a 96 well plate were washed once with 1xPBS and then trypsinised. Afterwards they were resuspended in PBS + 1% BSA and analyzed. EGFP and EBFP2 cellular intensities were measured with a flow cytometer was performed equipped with two laser diodes, one at 405nm and one at 488nm. The fluorescence of EGFP and EBFP2 was separated at 495nm by a dichroic mirror. Each signal was filtered through two emission filters: the first with the band pass between 425nm and 475nm to detect EBFP2, the second between 497.5nm and 522.5nm to detect EGFP. The bleed through was compensated by measuring cells only expressing EGFP and accordingly EBFP2. For the measurements 100µl cells in PBS + 1% BSA were pumped by the machine and about 10000 cells were analysed for each construct.<br />
<br />
<br />
* Consumables and Chemicals<br />
Falcon Becton Dickinson Microtest 96, product number: 353072 <br><br />
1x PBS (1.37mM NaCl, 0.27mM KCl, 10mM Na2HPO4, 0.2mM KH2PO4) <br><br />
Bovine Serum Albumine, Sigma, product number: A9647 <br><br />
<br />
<br />
* Instruments<br />
Beckman Coulter Cytomics FC500MPL<br />
<br />
<br />
*Analysis<br />
The reduction of EGFP expression compared to EBFP2 that we observed by flow cytometry could be quantitated as follow: two-dimensional scatter count plots representing cell counts for each EBFP2-EGFP intensity pair on a linear scale were exported as 64X64 pixel images. To ignore non-transfected cells, a square of 3X3 pixel originating from (0,0), where control non-transfected cells accumulate, was put to zero in each count plot. A ratio image of the same size containing the EGFP-EBFP2 intensity ratio for each pixel was generated. The mean ratio was estimated by multiplying each count plot with the ratio image, measuring the total image intensity and dividing it by the total count of each count plot. For the standard deviation, the mean intensity of a count plot was subtracted to the ratio image. the square of each pixel intensity was multiplied by the corresponding count and the total intensity of the result was divided by the total count. The standard deviation was then calculated by taking the square root of this number. All steps were performed on imageJ. <br />
<br />
<br />
<br><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
=== Dual Luciferase Assay ===<br />
We measured the knockdown of firefly luciferase using the [http://www.promega.com/tbs/tm046/tm046.pdf Promega Dual Luciferase Reporter Assay]. <br />
The DLR™ Assay System provides an efficient mean of performing dual-reporter assays, where the activities of firefly (<i>Photinus pyralis</i>) and Renilla (<i>Renilla reniformis</i>) luciferases (RL) are measured sequentially from a single sample. Firefly and Renilla luciferases can be used as a good reporter system, as those two enzymes have dissimilar enzyme structures and substrate requirements. This allows for selective discrimination between their bioluminescent reactions. The firefly luciferase (FL) reporter is measured first by adding Luciferase Assay Reagent II (LAR II) to generate a stabilized luminescent signal. After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is simultaneously initiated by adding Stop & Glo® Reagent to the same tube. The Stop & Glo® Reagent also produces a stabilized signal from the Renilla luciferase, which decays slowly over the course of the measurement. Here, Renilla luciferase is used for normalization. The measurements were conducted on the Promega GLOMAX 96 Microplate Luminometer using the Promega standard protocol ([https://2010.igem.org/Team:Heidelberg/Project/References#Materials_and_Methods Sherf et al., 1996]). <br><br />
Twenty hours after transfection, cells were washed with 1x PBS and lysed using 1x Passive Lysis Buffer (5x stock solution diluted with distilled water), shaking for 30 minutes at 37°C. 10µl of the lysate were transferred to a white microplate (LumaPlate) as required for Luminometer measurements. <br />
<br />
LAR II reagent was prepared by resuspending Luciferase Assay Substrate in 10ml Luciferase Assay Buffer II. For Stop & Glo reagent, 2.1ml 50x Stop & Glo substrate and 105ml Stop & Glo Buffer were added to the amber Stop & Glo reagent bottle and mixed by vortexing. Reagents where stored in 15ml aliquots at -80°C and thawed freshly prior to each measurement.<br />
<br />
To set up the Luminometer, the two injectors where flushed with distilled water, 70% ethanol, again water and air, three times each. Afterwards, they were primed three times with substrate reagents. <br />
<br />
The activity of the first luciferase (firefly) was measured by adding 25µl of LAR II reagent to the well. The enzyme reacts upon translation without further processing and oxidates beetle luciferin, resulting in photon emission that can be measured. In addition to beetle luciferin, the LAR II reagent contains coenzyme A, which accelerates the reaction and thus creates a prolonged luminescence signal. The luminescence was measured two seconds after addition of the reagent, for ten seconds. Afterwards, 25µl Stop & Glo reagent was added, which is able to quench the firefly luciferase activity and simultaneously contains the substrate for Renilla luciferase, coelenterazine. This second reaction also emits photons upon oxidation of the substrate. Addition of substrates and light emission measurements were conducted automatically by the GLOMAX Luminometer.<br />
<br><br />
==== Order of recording and processing raw data ====<br />
# triple-transfection of the following constructs in ratio 10:1:1<br />
#* shRNA-like miRNA (shRNA miR) expressing plasmid (25 ng / well)<br />
#* reference construct containing hRluc (2.5 ng / well)<br />
#* tuning construct with Luc2 fused to binding site referring to shRNA miR (2.5 ng / well)<br />
#: note: used backbones for all constructs were either pBS_U6 or pBS_H1<br />
# measurement of bioluminescent signal after substrate addition<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_date_samples_ctrl_BB.xls<br />
## first injection: LARII<br />
##* quantification of Firefly signal<br />
## second injection: Stop & Glo® Reagent<br />
##* quantification of Renilla signal<br />
# calculate signal ratio: Firefly/Renilla<br />
#: note: Renilla is used as a reference, Firefly signal determines binding site strength<br />
#* controls on every plate: perfect binding site (lower expression limit), no binding site (upper expression limit = 100%) defining overall expression range<br />
#* another control: separate triple-transfections of tuning constructs with a shRNA miR expression plasmid that is ''not'' corresponding to the binding site on the tuning construct (upper expression limit)<br />
# normalization by control without binding site<br />
#* thus, normalized value corresponds to knockdown percentage<br />
# deviation of knockdown percentage for corresponding shRNA miR by referring knockdown percentage of non-corresponding shRNA miR<br />
# calculate mean values and standard deviation (out of eight replicates) for each construct containing imperfect binding site (intermediate expression)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: plate#_process_BB_shRNA.xls<br />
#* note: error propagation has to be taken into account<br />
# grade calculated knockdown percentages in ascending order (lowest value always for perfect binding site, whereas maximum value without binding site)<br />
#: raw data file with following <html><a name="nomenclature" href="#nomenclature">nomenclature</a></html>: shRNA_BB_final.xlsx<br />
<br/><br />
===== nomenclature =====<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|'''table 1''': Used nomenclature for raw data files.<br />
| abbreviation||meaning||example<br />
|-<br />
|shRNA||expressed shRNA miR||shRNA miR against hAAT ("hAAT")<br />
|-<br />
|date||date of measurement in format YYYYMMDD||20101026<br />
|-<br />
|samples||internal ID of constructs||M1-M6<br />
|-<br />
|BB||plasmid backbone||either pBS_U6 ("U6") or pBS_H1 ("H1")<br />
|-<br />
|plate#||number of measured 96 well plate||plate1<br />
|-<br />
|}<br />
<br/><br />
<br />
==== Consumables and Reagents ====<br />
LumaPlate, PerkinElmer, catalogue number 6005630<br><br />
[http://www.promega.com/tbs/tm046/tm046.pdf, Promega Dual-Luciferase® Reporter Assay System], catalogue number E1910<br />
<br><br />
<br />
==== Instruments ====<br />
Promega GLOMAX 96 Microplate Luminometer<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T22:09:40Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''1'''||'''2'''||'''3'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''6'''||'''7'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#30.2F10.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#31.2F10.2F2010 31]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
Actual ideas for therapeutic treatments of diseases like (???) include the use of virus for cell or tissue specific "drug" targeting. Where the delivery by the virus may cure the patient if targeted to the right cell, major problems are side effects coming up when mistargeted virus deliver their cargo to non-targeted cells. As the standard load of a virus is DNA and the pharmacological function results in expression of its information, our idea is to control the delivered DNA outcome. Therefore we want to use cell type specific micro RNA (miRNA) expression levels for activation of the therapeutic treatment.<br />
<br />
As miRNAs are naturally used in cells to regulate translation, usage of the existing system for self-regulation sounds obvious. So we tried to create binding sites for miRNAs to target our constructs and either shut-down (off-targeting) or activate (on-targeting) gene expression in targeted tissues. In the off-targeting strategy the therapeutic gene is itself targeted for RNAi, so expression will persist only in non-targeted cells. In the on-targeting strategy, two different constructs built up an operator/repressor system (e.g. Tet-On/Off), where the regulator of the therapeutic gene, the repressor, is targeted for RNAi. Only cells which are able to suppress translation of the repressor will be affected from the therapeutic gene.<br />
<br />
To achieve this, we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team and adopted it to our purposes.<br />
The differences: Sequences from 100 to 400 base pairs are requested. Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) targeting of miRNAs<br />
:*distance and sequence between miRBS (spacer region)<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-27T20:48:03Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
== 10/02/2010 ==<br />
<br /><br />
*digestion in 50 µl of <br />
**4x pSB1C3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
**4x pSB1A3 (5µl BSA, 5µl NEB buffer 2, 1µl PstI, 1µl EcoRI, 1µl DpnI, 4µl construct, 33 µl H2O)<br />
<br />
== 10/05/2010 ==<br />
<br /><br />
*1µg digestion of miMeasure and 6 different constructs (1A, 3F, 13, 15, 17, 37) with EcoRI and PstI<br />
<br />
:1= 0S<br />
:2= 0L<br />
:3= 10S<br />
:4= 10L<br />
<br />
20 Miniprep:<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: 20 Minis'''<br />
|Number||binding site against miRNA x||Position<br />
|-<br />
|1||221||3.5<br />
|-<br />
|2||221||1.4<br />
|-<br />
|3||1179||3.1<br />
|-<br />
|4||4286||2.6<br />
|-<br />
|5||4286||4.1<br />
|-<br />
|6||4286||3.4<br />
|-<br />
|7||1179||4.4<br />
|-<br />
|8||1179|3.5<br />
|-<br />
|9||1179||1.9<br />
|-<br />
|10||221||4.6<br />
|-<br />
|11||221||1.5<br />
|-<br />
|12||4286||3.5<br />
|-<br />
|13||221||4.8<br />
|-<br />
|14||221||2.3<br />
|-<br />
|15||4286||2.2<br />
|-<br />
|16||4286||1.3<br />
|-<br />
|17||1179||2.5<br />
|-<br />
|18||1179||2.4<br />
|-<br />
|19||1179||1.5<br />
|-<br />
|20||1179||4.8<br />
|}<br />
----<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T19:34:08Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''|||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#30.2F10.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#31.2F10.2F2010 31]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
Actual ideas for therapeutic treatments of diseases like (???) include the use of virus for cell or tissue specific "drug" targeting. Where the delivery by the virus may cure the patient if targeted to the right cell, major problems are side effects coming up when mistargeted virus deliver their cargo to non-targeted cells. As the standard load of a virus is DNA and the pharmacological function results in expression of its information, our idea is to control the delivered DNA outcome. Therefore we want to use cell type specific micro RNA (miRNA) expression levels for activation of the therapeutic treatment.<br />
<br />
As miRNAs are naturally used in cells to regulate translation, usage of the existing system for self-regulation sounds obvious. So we tried to create binding sites for miRNAs to target our constructs and either shut-down (off-targeting) or activate (on-targeting) gene expression in targeted tissues. In the off-targeting strategy the therapeutic gene is itself targeted for RNAi, so expression will persist only in non-targeted cells. In the on-targeting strategy, two different constructs built up an operator/repressor system (e.g. Tet-On/Off), where the regulator of the therapeutic gene, the repressor, is targeted for RNAi. Only cells which are able to suppress translation of the repressor will be affected from the therapeutic gene.<br />
<br />
To achieve this, we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team and adopted it to our purposes.<br />
The differences: Sequences from 100 to 400 base pairs are requested. Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) targeting of miRNAs<br />
:*distance and sequence between miRBS (spacer region)<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesignTeam:Heidelberg/Notebook/BSDesign2010-10-27T19:00:21Z<p>Kleinsorg: /* Binding Site Design */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#4e93a4; border:1.53px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#c85000;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July<font color="white">July</font>]<br />
|- style="background:#c85000; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#05.2F07.2F2010_-_11.2F07.2F2010 11]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 12]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#12.2F07.2F2010_-_19.2F07.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#20.2F07.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#21.2F07.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#22.2F07.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#23.2F07.2F2010 23]'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#26.2F07.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#27.2F07.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#28.2F07.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#29.2F07.2F2010 29]'''||'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July#31.2F07.2F2010 31]'''||<br />
|- style="background:#f2f2f2; color:#f09600" <br />
| colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="6"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#01.2F08.2F2010 1]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#02.2F08.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#03.2F08.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#04.2F08.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#05.2F08.2F2010 5]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#06.2F08.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#07.2F08.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#08.2F08.2F2010 8]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#09.2F08.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#10.2F08.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/August#11.2F08.2F2010 11]'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''30'''||'''31'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/September#30.2F30.2F2010 30]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/August#31.2F08.2F2010 31]'''||colspan="5"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
=Binding Site Design=<br />
<br />
==Introduction==<br />
<br />
Actual ideas for therapeutic treatments of diseases like (???) include the use of virus for cell or tissue specific "drug" targeting. Where the delivery by the virus may cure the patient if targeted to the right cell, major problems are side effects coming up when mistargeted virus deliver their cargo to non-targeted cells. As the standard load of a virus is DNA and the pharmacological function results in expression of its information, our idea is to control the delivered DNA outcome. Therefore we want to use cell type specific micro RNA (miRNA) expression levels for activation of the therapeutic treatment.<br />
<br />
As miRNAs are naturally used in cells to regulate translation, usage of the existing system for self-regulation sounds obvious. So we tried to create binding sites for miRNAs to target our constructs and either shut-down (off-targeting) or activate (on-targeting) gene expression in targeted tissues. In the off-targeting strategy the therapeutic gene is itself targeted for RNAi, so expression will persist only in non-targeted cells. In the on-targeting strategy, two different constructs built up an operator/repressor system (e.g. Tet-On/Off), where the regulator of the therapeutic gene, the repressor, is targeted for RNAi. Only cells which are able to suppress translation of the repressor will be affected from the therapeutic gene.<br />
<br />
To achieve this, we used the random assembly PCR (raPCR) – method from iGEM2009-Heidelberg team and adopted it to our purposes.<br />
The differences: Sequences from 100 to 400 base pairs are requested. Oligos span over a whole binding site for a certain miRNA and shuffling occurs on the level of pattern creation.<br />
Several points need to be considered for setting up miRNA-binding site (miRBS) patterns:<br />
:*the right distance after the stop codon for efficient (or non-efficient) targeting of miRNAs<br />
:*distance and sequence between miRBS (spacer region)<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T18:28:08Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
{{:Team:Heidelberg/Side_Top}} <br />
__TOC__<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
=miMeasure=<br />
==Abstract==<br />
<br />
With the rising importance of small RNA molecules in gene therapy the identification and characterization of miRNAs and their binding sites become crucial for innovative applications. In order to exploit the miRNA ability to target and regulate specific genes, we constructed a measurement standard not only to characterize existing miRNAs but also to validate potential synthetic miRNAs for a new therapeutic approach. The synthetic miRNAs we created are inert for endogenous targets and thus applicable for gene regulation without any direct side effects. This opens new possibilities for precise expression tuning, especially in quantitative means. <br />
Our [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miMeasure] construct plasmid normalizes knockdown of the green fluorescent protein (EGFP) to the blue fluorescent protein (EBFP2). This allows for an accurate study of binding site properties, since both fluorescent proteins are combined in the same construct and driven by the same [http://partsregistry.org/Part:BBa_K337017 bidirectional promoter]. Another advantage is, that any desired binding site can be cloned easily into the miMeasure plasmid with the [http://dspace.mit.edu/handle/1721.1/45139 BB-2 standard]. As the binding site is inserted downstream of EGFP, a regulation of EGFP expression is to be expected. <br />
The percentage of knockdown of each modified binding site can be calculated by the ratio of EGFP to EBFP2. This ratio is derived from a linear regression curve. Therefore the knock-down efficiency can be determined by various basic methods e.g. plate reading, flow cytometry or [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, we also measured the knockdown achieved by the perfect binding site and set this as 100% knockdown efficiency. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP (by Clontech) and a dsEBFP2 that was derived from the same sequence. Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency (in percent, compared to perfect binding site=100% and no binding site=0%) of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==Results==<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. 10000 cells are measured. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot represents one fluorescent cell. The two different coloured dots belong to two different measurements. Both sets of dots make up a line, which shows the correlation of EGFP and EBFP2 very well. The orange dots represent cells, which were transfected with different miMeasure constructs and the miRsAg. The blue dots represent cells, which were also transfected with the different miMeasure constructs, but here the miR-155 is cotransfected, which doesn't have any specificity for the binding sites. The cotransfection with miR-155 is therefore the negative control. If the dots become white, it means the orange and blue ones overlap. So both lines overlap in the negative control, whereas the orange line is going up for the miMeasure construct with the perfect binding site. All the other constructs look like the negative control. <br />
<br />
[[Image:Flow_miR122.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The Hela cells transfected with the different constructs are also imaged with the epifluorescent microscope. The cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are mostly green, whereas the cells with the miMeasure construct containing the perfect binding sites (see b) are mostly blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The knock-down efficiency of the binding site, which have bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/OctoberTeam:Heidelberg/Notebook/BSDesign/October2010-10-27T18:10:33Z<p>Kleinsorg: New page: {{:Team:Heidelberg/Single}} {{:Team:Heidelberg/Single_Pagetop|note_BSDesign}} {{:Team:Heidelberg/Side_Top}} {{:Team:Heidelberg/Side_Bottom}} __NOTOC__ = Binding Site Design - October = ...</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - October =<br />
<br />
----<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:HeidelbergTeam:Heidelberg2010-10-27T17:40:29Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/NivoSlider}}<br />
<html><br />
<br />
<!--<br />
<br />
============================================================================================<br />
*** PLEASE NOTE: ***<br />
<br />
The contents and design of this wiki are published under the GNU Free Documentation License. You are granted the right to copy and modify our work, but you must publish your work under the same type of license while recognizing us the authors.<br />
<br />
Stefan Kleinsorg, Thomas Uhlig<br />
<br />
============================================================================================<br />
<br />
/--><br />
<br />
<style type="text/css"><br />
<br />
#pics {<br />
margin-left:-5px;<br />
margin-right:-5px;<br />
text-align:center;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d2/IGEM_official_gray4.png); <br />
background-repeat: no-repeat;<br />
background-position: center;<br />
}<br />
<br />
.piclinks {<br />
border:none;<br />
text-decoration:none;<br />
position:relative;<br />
z-index:5;<br />
}<br />
<br />
#desc-table {<br />
width:370px;<br />
height:170px;<br />
border: none;<br />
background:transparent;<br />
margin:10px 0px;<br />
} <br />
<br />
#desc {<br />
border: none;<br />
background:transparent;<br />
padding:0px;<br />
text-align:justify;<br />
font-size:12pt;<br />
}<br />
<br />
a { outline:0}<br />
<br />
#wrapperheadline {<br />
position:relative;<br />
font-size: 14pt;<br />
font-weight:bold;<br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var modelarray = new Array();<br />
var teamarray = new Array();<br />
var humanarray = new Array();<br />
var notearray = new Array();<br />
var partsarray = new Array();<br />
var suparray = new Array();<br />
<br />
for (var i = 0; i <= 3; i++) {<br />
modelarray[i] = new Image();<br />
teamarray[i] = new Image();<br />
humanarray[i] = new Image();<br />
notearray[i] = new Image();<br />
partsarray[i] = new Image();<br />
suparray[i] = new Image();<br />
}<br />
<br />
modelarray[1].src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png";<br />
modelarray[2].src="https://static.igem.org/mediawiki/2010/a/a6/Modeling_hover.png";<br />
modelarray[3].src="https://static.igem.org/mediawiki/2010/e/e1/Modeling_down.png";<br />
<br />
teamarray[1].src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png";<br />
teamarray[2].src="https://static.igem.org/mediawiki/2010/d/d2/Team_hover.png";<br />
teamarray[3].src="https://static.igem.org/mediawiki/2010/9/97/Team_down.png";<br />
<br />
humanarray[1].src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png";<br />
humanarray[2].src="https://static.igem.org/mediawiki/2010/1/1e/Human_practices_hover.png";<br />
humanarray[3].src="https://static.igem.org/mediawiki/2010/d/d6/Human_practices_down.png";<br />
<br />
notearray[1].src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png";<br />
notearray[2].src="https://static.igem.org/mediawiki/2010/1/18/Notebook_hover.png";<br />
notearray[3].src="https://static.igem.org/mediawiki/2010/a/a5/Notebook_down.png";<br />
<br />
partsarray[1].src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png";<br />
partsarray[2].src="https://static.igem.org/mediawiki/2010/3/38/Parts_hover.png";<br />
partsarray[3].src="https://static.igem.org/mediawiki/2010/c/c0/Parts_down.png";<br />
<br />
suparray[1].src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png";<br />
suparray[2].src="https://static.igem.org/mediawiki/2010/2/22/Support_hover.png";<br />
suparray[3].src="https://static.igem.org/mediawiki/2010/8/8d/Support_down.png";<br />
<br />
function writeText(txt)<br />
{document.getElementById("desc").innerHTML=txt; }<br />
<br />
function swap(num,effect) {<br />
<br />
switch (num) {<br />
<br />
case 1: document.getElementById("pic"+num).src =modelarray[effect].src;<br />
break;<br />
case 2: document.getElementById("pic"+num).src =teamarray[effect].src;<br />
break;<br />
case 3: document.getElementById("pic"+num).src =humanarray[effect].src;<br />
break;<br />
case 4: document.getElementById("pic"+num).src =notearray[effect].src;<br />
break;<br />
case 5: document.getElementById("pic"+num).src =partsarray[effect].src;<br />
break;<br />
case 6: document.getElementById("pic"+num).src =suparray[effect].src;<br />
break;<br />
}<br />
} <br />
<br />
function mouseOver(num) {<br />
swap(num,2);<br />
}<br />
<br />
function mouseOut(num)<br />
{<br />
swap(num,1);<br />
}<br />
<br />
function mouseDown(num)<br />
{<br />
swap(num,3);<br />
}<br />
<br />
function mouseUp(num)<br />
{<br />
swap(num,2);<br />
}<br />
<br />
</script><br />
</html><br />
{{:Team:Heidelberg/Pagetop|home}}<br />
<html><br />
<br />
<div id="wrapperheadline">iGEM Heidelberg Mission 2010: miBricks</div><br />
<div id="slider"><br />
<a href="https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling"><img src="https://static.igem.org/mediawiki/2010/e/ed/Slide_CapShuffling.png" alt="" rel="https://static.igem.org/mediawiki/2010/3/30/Slide_CapShuffling_thumb.png"/></a><br />
<a href="https://2010.igem.org/Team:Heidelberg/Modeling"><img src="https://static.igem.org/mediawiki/2010/f/fc/Bioinfo.png" alt="" rel="https://static.igem.org/mediawiki/2010/0/0d/Bioinfo_thumb.png"/></a><br />
</div><br><br><br><br><br />
<br />
<br />
<div id="pics"><br />
<a class="piclinks" href="javascript:writeText('And we are not talking about fashion! In our team, a group of students was in charge of the computational interpretation and modeling of the data generated. Want to read more? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Modeling&quot;>here</a>!')" onMouseOver="mouseOver(1)" onMouseOut="mouseOut(1)" onMouseDown="mouseDown(1)" onMouseUp="mouseUp(1)"><br />
<img id="pic1" border=0 src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team comprised a group of twenty motivated students from eight different countries, two instructors and eight advisors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Team&quot;>here</a>!')" onMouseOver="mouseOver(2)" onMouseOut="mouseOut(2)" onMouseDown="mouseDown(2)" onMouseUp="mouseUp(2)"><br />
<img id="pic2" border=0 src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png"; /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('A philosophy and a psychology student helped us to understand how Synthetic Biology interacts with society. Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Human_Practices&quot;>here</a> to see how our science is percieved by the public!')" onMouseOver="mouseOver(3)" onMouseOut="mouseOut(3)" onMouseDown="mouseDown(3)" onMouseUp="mouseUp(3)"><br />
<img id="pic3" border=0 src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png" /><br />
</a><br />
<br />
<center><table id="desc-table"><tr><td><div id ="desc" border=0><center>Please click a Button to get more information! </center></div></td></tr></table></center><br />
<br />
<br />
<a class="piclinks" href="javascript:writeText('As in any piece of research, we have been keeping detailed notebooks with the experiments we have done. Want to retrace our steps? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Notebook&quot;>here</a>!')" onMouseOver="mouseOver(4)" onMouseOut="mouseOut(4)" onMouseDown="mouseDown(4)" onMouseUp="mouseUp(4)"><br />
<img id="pic4" border=0 src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('We have generated more than 100 parts that have been sent to iGEM headquarters. Want to know which ones? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Parts&quot;>here</a>!')" onMouseOver="mouseOver(5)" onMouseOut="mouseOut(5)" onMouseDown="mouseDown(5)" onMouseUp="mouseUp(5)"><br />
<img id="pic5" border=0 src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team was sponsored by a non-profit organization, nine companies and three academic sponsors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Support&quot;>here</a>!')" onMouseOver="mouseOver(6)" onMouseOut="mouseOut(6)" onMouseDown="mouseDown(6)" onMouseUp="mouseUp(6)"><br />
<img id="pic6" border=0 src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png" /><br />
</a><br />
</div><br><br><br />
<div class="clear"></div><br />
</div><br />
<br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<body><br />
<br />
<object type="application/x-shockwave-flash" data="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&bgcolor=f2f2f2&date_month=11&date_day=05&date_year=0&un=IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" width="250" height="80"><param name="movie" value="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&date_month=11&date_day=05&date_year=0&un=UNTIL IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" /><param name="bgcolor" value="#f2f2f2" /></object><br />
<br />
<p>... and way more important:</p><br />
<object type="application/x-shockwave-flash" data="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&bgcolor=f2f2f2&date_hour=06&date_month=10&date_day=28&date_year=0&un=WIKI FREEZE&size=normal&ho=06&mo=10&da=28&yr=2010" width="250" height="80"><param name="movie" value="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&date_hour=06&date_month=10&date_day=28&date_year=0&un=UNTIL IGEM JAMBOREE 2010&size=normal&mo=10&da=28&yr=2010" /><param name="bgcolor" value="#f2f2f2" /></object><br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<div id="projectabstract"><span class="t3">The key to successful gene therapy</span><br>... is integration of tissue specificity and fine-tuned target gene expression. iGEM Team Heidelberg 2010 unlocks the world of synthetic microRNAs. We engineered a toolkit for standardized measurements of interactions between artificial miRNAs and their binding sites. Thus, the expression level of any gene of choice could be arbitrarily adjusted by employing the corresponding binding site design. To produce tissue specific miRNA gene shuttles, we developed an evolution-based method for synthesis of new adeno associated viruses. In the future, miBricks could open the doors to new Synthetic Biology based medical approaches. </div><br><br><br><br />
<br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T16:09:08Z<p>Kleinsorg: /* 15/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we <br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S ("zero small")<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L ("zero large")<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S ("ten small")<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L ("ten large")<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T16:08:14Z<p>Kleinsorg: /* 14/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we <br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122_-fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S (for zero small)<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L (for zero large)<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S (for ten small)<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L (for ten large)<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/File:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.pngFile:2010-09-20 - psiCHECK2 digest single notI xho -fertig.png2010-10-27T16:03:46Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/File:2010-09-14_-_raPCR_miR375-376-klein_fertig.pngFile:2010-09-14 - raPCR miR375-376-klein fertig.png2010-10-27T16:03:40Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/File:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.pngFile:2010-09-14 - raPCR miR122ran + miR375 376 prep fertig.png2010-10-27T16:03:36Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/File:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.pngFile:2010-09-14 - raPCR miR122(ran9-12) fertig.png2010-10-27T16:03:31Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/File:2010-09-14_-_raPCR_miR122_prep_fertig.pngFile:2010-09-14 - raPCR miR122 prep fertig.png2010-10-27T16:03:28Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/File:2010-09-14_-_raPCR_miR122_-fertig.pngFile:2010-09-14 - raPCR miR122 -fertig.png2010-10-27T16:03:08Z<p>Kleinsorg: </p>
<hr />
<div></div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T14:50:39Z<p>Kleinsorg: /* 08/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence to seperate the single binding sites by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found two 15bp-spacer, which make up a total 30bp-spacer, with low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
Spacer sequence: <br />
:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span style="color:#009be1">SECOND HALF</span><span style="color:#78b41e">FIRST HALF</span><br />
:<span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
Additionally we <br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122-klein_fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S (for zero small)<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L (for zero large)<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S (for ten small)<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L (for ten large)<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T14:09:23Z<p>Kleinsorg: /* 08/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
Beside this, it is known that hsa-mir-122 is expressed in liver uniquely, at least for humans. Additionally, mm-mir-375/376a are uniquely expressed in mouse livers. As we are heading for divergent prospective experiments, first we want to show that the principle of using endogenous miRNAs for tissue identification tasks is compatible with our constructs for luciferase measurements (compare to '''[https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit Synthetic miRNA-Kit]''') and our new measurement standard '''[https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure]'''.<br />
<br />
As it is known !!!reference!!! that multiple miRNA binding sites in a row increase the knock-down efficiency of miRNAs, binding patterns may help to find the right threshold for specific tissue targeting.<br />
Therefore we created a spacer sequence by rational design with a GC content of 50%. This spacer need to be as innert as possible, in terms of miRNA recognition, so the sequence was then tested for compatibility with other miRNAs. We found a 30 bp spacer which had low compatiblity to any miRNA given by the tools mentioned. Highest achieved mean free energy was higher than -30 kcal/mol (the higher, the less effective is the binding), whereas a perfect binding miRNA was, in our cases, always under -40 kcal/mol. <br />
<br />
Spacer sequence: <span style="color:#009be1">GCATACATGGACTGC</span><span style="color:#78b41e">CACTGAATCCAACTG</span><br />
<br />
For our random assembly PCR approach, we created oligos using this spacer-sequence as annealing site. Therefore we split the spacer in two halfs, and placed a miRNA binding site in between:<br />
:<span style="color:#78b41e">CACTGAATCCAACTG</span>-miRNA binding site-<span style="color:#009be1">GCATACATGGACTGC</span><br />
<br />
This first and second half of he spacer are <br />
<br />
Additionally <br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122-klein_fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S (for zero small)<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L (for zero large)<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S (for ten small)<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L (for ten large)<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T14:08:31Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks- The Parts Concept=<br />
<br><br />
<br />
The parts we submit refer to the two core aims our project is focusing on: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interst in any target cell or tissue of choice. Therefor we engineered parts, that adress those two aims on two different regulatory levels. <br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses. On parts level, we provide about 50 plasmids that can be used for creating shuffeled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts, we refer to as virobytes, are designed in a format, that is directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we provide.<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consits of three main constructs: The pSMB_miMeasure binding site characterization standard and two pSMB_miTuner expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate constrution parts, synthetic single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==Endogenous Binding Site Patterns==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Tuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:HeidelbergTeam:Heidelberg2010-10-27T13:48:21Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<style type="text/css"><br />
<br />
#pics {<br />
margin-left:-5px;<br />
margin-right:-5px;<br />
text-align:center;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d2/IGEM_official_gray4.png); <br />
background-repeat: no-repeat;<br />
background-position: center;<br />
}<br />
<br />
.piclinks {<br />
border:none;<br />
text-decoration:none;<br />
position:relative;<br />
z-index:5;<br />
}<br />
<br />
#desc-table {<br />
width:370px;<br />
height:170px;<br />
border: none;<br />
background:transparent;<br />
margin:10px 0px;<br />
} <br />
<br />
#desc {<br />
border: none;<br />
background:transparent;<br />
padding:0px;<br />
text-align:justify;<br />
font-size:12pt;<br />
}<br />
<br />
a { outline:0}<br />
<br />
#wrapperheadline {<br />
position:relative;<br />
font-size:1.6em;<br />
font-weight:bold;<br />
}<br />
<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
var modelarray = new Array();<br />
var teamarray = new Array();<br />
var humanarray = new Array();<br />
var notearray = new Array();<br />
var partsarray = new Array();<br />
var sponsarray = new Array();<br />
<br />
for (var i = 0; i <= 3; i++) {<br />
modelarray[i] = new Image();<br />
teamarray[i] = new Image();<br />
humanarray[i] = new Image();<br />
notearray[i] = new Image();<br />
partsarray[i] = new Image();<br />
sponsarray[i] = new Image();<br />
}<br />
<br />
modelarray[1].src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png";<br />
modelarray[2].src="https://static.igem.org/mediawiki/2010/a/a6/Modeling_hover.png";<br />
modelarray[3].src="https://static.igem.org/mediawiki/2010/e/e1/Modeling_down.png";<br />
<br />
teamarray[1].src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png";<br />
teamarray[2].src="https://static.igem.org/mediawiki/2010/d/d2/Team_hover.png";<br />
teamarray[3].src="https://static.igem.org/mediawiki/2010/9/97/Team_down.png";<br />
<br />
humanarray[1].src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png";<br />
humanarray[2].src="https://static.igem.org/mediawiki/2010/1/1e/Human_practices_hover.png";<br />
humanarray[3].src="https://static.igem.org/mediawiki/2010/d/d6/Human_practices_down.png";<br />
<br />
notearray[1].src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png";<br />
notearray[2].src="https://static.igem.org/mediawiki/2010/1/18/Notebook_hover.png";<br />
notearray[3].src="https://static.igem.org/mediawiki/2010/a/a5/Notebook_down.png";<br />
<br />
partsarray[1].src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png";<br />
partsarray[2].src="https://static.igem.org/mediawiki/2010/3/38/Parts_hover.png";<br />
partsarray[3].src="https://static.igem.org/mediawiki/2010/c/c0/Parts_down.png";<br />
<br />
sponsarray[1].src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png";<br />
sponsarray[2].src="https://static.igem.org/mediawiki/2010/2/22/Support_hover.png";<br />
sponsarray[3].src="https://static.igem.org/mediawiki/2010/8/8d/Support_down.png";<br />
<br />
function writeText(txt)<br />
{document.getElementById("desc").innerHTML=txt; }<br />
<br />
function swap(num,effect) {<br />
<br />
switch (num) {<br />
<br />
case 1: document.getElementById("pic"+num).src =modelarray[effect].src;<br />
break;<br />
case 2: document.getElementById("pic"+num).src =teamarray[effect].src;<br />
break;<br />
case 3: document.getElementById("pic"+num).src =humanarray[effect].src;<br />
break;<br />
case 4: document.getElementById("pic"+num).src =notearray[effect].src;<br />
break;<br />
case 5: document.getElementById("pic"+num).src =partsarray[effect].src;<br />
break;<br />
case 6: document.getElementById("pic"+num).src =sponsarray[effect].src;<br />
break;<br />
}<br />
} <br />
<br />
function mouseOver(num) {<br />
swap(num,2);<br />
}<br />
<br />
function mouseOut(num)<br />
{<br />
swap(num,1);<br />
}<br />
<br />
function mouseDown(num)<br />
{<br />
swap(num,3);<br />
}<br />
<br />
function mouseUp(num)<br />
{<br />
swap(num,2);<br />
}<br />
<br />
</script><br />
</html><br />
{{:Team:Heidelberg/Pagetop|home}}<br />
<html><br />
<br />
<div id="wrapperheadline">iGEM Heidelberg Mission 2010: miBricks</div><br><br><br />
<br />
<div id="projectabstract">The key to successful gene therapy is integration of tissue specificity and fine-tuned target gene expression. iGEM Team Heidelberg 2010 unlocks the world of synthetic microRNAs. We engineered a toolkit for standardized measurements of interactions between artificial miRNAs and their binding sites. Thus, the expression level of any gene of choice could be arbitrarily adjusted by employing the corresponding binding site design. To produce tissue specific miRNA gene shuttles, we developed an evolution-based method for synthesis of new adeno associated viruses. In the future, miBricks could open the doors to new Synthetic Biology based medical approaches. </div><br><br><br />
<br />
<div id="pics"><br />
<a class="piclinks" href="javascript:writeText('And we are not talking about fashion! In our team, a group of students was in charge of the computational interpretation and modeling of the data generated. Want to read more? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Modeling&quot;>here</a>!')" onMouseOver="mouseOver(1)" onMouseOut="mouseOut(1)" onMouseDown="mouseDown(1)" onMouseUp="mouseUp(1)"><br />
<img id="pic1" border=0 src="https://static.igem.org/mediawiki/2010/2/2d/Modeling_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team comprised a group of twenty motivated students from eight different countries, two instructors and eight advisors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Team&quot;>here</a>!')" onMouseOver="mouseOver(2)" onMouseOut="mouseOut(2)" onMouseDown="mouseDown(2)" onMouseUp="mouseUp(2)"><br />
<img id="pic2" border=0 src="https://static.igem.org/mediawiki/2010/8/82/Team_none.png"; /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('We had the help of a Philosophy student and a Psychology student to help all of us understand how does Synthetic Biology interact with society. Sounds interesting, right? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Human_Practices&quot;>here</a>!')" onMouseOver="mouseOver(3)" onMouseOut="mouseOut(3)" onMouseDown="mouseDown(3)" onMouseUp="mouseUp(3)"><br />
<img id="pic3" border=0 src="https://static.igem.org/mediawiki/2010/a/a7/Human_practices_none.png" /><br />
</a><br />
<br />
<center><table id="desc-table"><tr><td><div id ="desc" border=0><center>Please click a Button to get more information! </center></div></td></tr></table></center><br />
<br />
<br />
<a class="piclinks" href="javascript:writeText('As in any piece of research, we have been keeping detailed notebooks with the experiments we have done. Want to retrace our steps? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Notebook&quot;>here</a>!')" onMouseOver="mouseOver(4)" onMouseOut="mouseOut(4)" onMouseDown="mouseDown(4)" onMouseUp="mouseUp(4)"><br />
<img id="pic4" border=0 src="https://static.igem.org/mediawiki/2010/8/8f/Notebook_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('We have generated more than 50 parts that have been sent to iGEM headquarters. Want to know which ones? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Parts&quot;>here</a>!')" onMouseOver="mouseOver(5)" onMouseOut="mouseOut(5)" onMouseDown="mouseDown(5)" onMouseUp="mouseUp(5)"><br />
<img id="pic5" border=0 src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png" /><br />
</a><br />
<br />
<a class="piclinks" href="javascript:writeText('Our team was sponsored by a non-profit organization, nine companies and three academic sponsors. Want to meet them? Click <a href=&quot;https://2010.igem.org/Team:Heidelberg/Support&quot;>here</a>!')" onMouseOver="mouseOver(6)" onMouseOut="mouseOut(6)" onMouseDown="mouseDown(6)" onMouseUp="mouseUp(6)"><br />
<img id="pic6" border=0 src="https://static.igem.org/mediawiki/2010/4/46/Support_none.png" /><br />
</a><br />
</div><br><br><br />
<div class="clear"></div><br />
</div><br />
<br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<br />
<br><img src="https://static.igem.org/mediawiki/2010/a/a4/Igemhd2010_2s.png" width="260px"/><br><br><br />
<object type="application/x-shockwave-flash" data="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&bgcolor=f2f2f2&date_month=11&date_day=05&date_year=0&un=IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" width="250" height="80"><param name="movie" value="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&date_month=11&date_day=05&date_year=0&un=UNTIL IGEM JAMBOREE 2010&size=normal&mo=11&da=05&yr=2010" /><param name="bgcolor" value="#f2f2f2" /></object><br />
<br />
<p>... and way more important:</p><br />
<object type="application/x-shockwave-flash" data="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&bgcolor=f2f2f2&date_hour=06&date_month=10&date_day=28&date_year=0&un=WIKI FREEZE&size=normal&ho=06&mo=10&da=28&yr=2010" width="250" height="80"><param name="movie" value="http://www.oneplusyou.com/bb/files/countdown/countdown.swf?co=F09600&date_hour=06&date_month=10&date_day=28&date_year=0&un=UNTIL IGEM JAMBOREE 2010&size=normal&mo=10&da=28&yr=2010" /><param name="bgcolor" value="#f2f2f2" /></object><br />
<br />
<br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T12:44:43Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
== 08/09/2010 ==<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
<br /><br />
=== 1. comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2. comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122-klein_fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S (for zero small)<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L (for zero large)<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S (for ten small)<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L (for ten large)<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorghttp://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/SeptemberTeam:Heidelberg/Notebook/BSDesign/September2010-10-27T11:33:27Z<p>Kleinsorg: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_BSDesign}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
<br />
= Binding Site Design - September =<br />
<br />
----<br />
<br />
= 08/09/2010 =<br />
<br />
'''Oligo design for random assembly PCR (raPCR)'''<br />
<br />
Using endogenous miRNAs for cell-identification, a detectable difference in miRNA-expression levels need to be present.<br />
Therefore we sent isolated RNA from HeLa, HUH7 and HEK-293 cells either infected with AAV or non-infected to [http://www.febit.com febit] for microarray analysation of micro-RNA expression levels. The obtained results were delivered in an evaluated form, showing relative expression levels between the different cell lines and/or conditions.<br />
For further experiments, the highest relative differences of two approaches were looked up:<br />
# comparison in one cell line between control and AAV infected status<br />
# comparison in one condition between different cell lines<br />
<br />
=== 1 comparison in one cell line between control and AAV infected status ===<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
|+ align="top, left"|'''table 1''': relative miRNA expression differences, compared between AAV infected and non-infected cells<br />
!Assay!!miRNA!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-520e || -4,68<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-126* || -3,77<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-502-5p || 3,79<br />
|-<br />
| HUH Ctr vs HUH AAV || hsa-miR-1179 || 4,00<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-221 || -0,84<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-125a-5p || -0,64<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-3130-3p || 0,58<br />
|-<br />
| HEK Ctr vs HEK AAV || hsa-miR-33bStar || 0,59<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-20a || -0,88<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-93 || -0,66<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-1228 || 0,84<br />
|-<br />
| HeLa Ctr vs HeLa AAV || hsa-miR-574-5p || 0,92<br />
|}<br />
<br />
Positive or negative log-values indicate upregulation or downregulation in AAV infected cells compared to non-infected cells of the same cell type, respectively.<br />
<br />
<br /><br /><br />
<br />
=== 2 comparison in one condition between different cell lines ===<br />
<br />
Here are the most up- and downregulated miRNAs shown. One of those were picked for further experiments.<br />
<br />
:Identify HUH cells from HeLa/HEK cells:<br />
::'''hsa-miR-574-5p'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -1,00<br />
|-<br />
| HUH Ctr vs HEK Ctr || -0,71<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,29<br />
|}<br />
::hsa-miR-574-5p is downregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-320b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 1,03<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,11<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 0,07<br />
|}<br />
::hsa-miR-320b is upregulated in HeLa and HEK cells, compared to HUH. Comparison between HeLa and HEK shows a relatively small difference in expression level.<br />
<br /><br />
:As for hsa-miR-320b the expression level between HeLa and HEK cells is closer to each other (compared to hsa-miR-574-5p), hsa-miR-574-5p might be the better choice.<br />
<br /><br /><br />
<br />
:Identify HeLa cells from HEK/HUH cells:<br />
::'''hsa-miR-29a'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH AAV vs HeLa AAV || -1,19<br />
|-<br />
| HeLa AAV vs HEK AAV || 1,3<br />
|-<br />
| HUH AAV vs HEK AAV || 0,11<br />
|}<br />
::hsa-miR-29a is downregulated in HUH and HEK cells, compared to HeLa. Comparison between HUHand HEK shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-4286'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,68<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -0,68<br />
|-<br />
| HUH Ctr vs HEK Ctr || 0<br />
|}<br />
::hsa-miR-4286 is upregulated in HUH and HEK cells, compared to HeLa. Comparison between HUH and HEK shows no difference in relative expression level.<br />
<br /><br />
:As there is no difference in the relative expression level detected for hsa-miR-4286, it is a promising choice for further experiments.<br />
<br /><br /><br />
<br />
:Identify HEK cells from HeLa/HUH cells:<br />
::'''hsa-miR-221'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || -1,13<br />
|-<br />
| HeLa Ctr vs HEK Ctr || -1,3<br />
|-<br />
| HUH Ctr vs HeLa Ctr || 0,17<br />
|}<br />
::hsa-miR-221 is downregulated in HeLa and HUH cells, compared to HEK. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
::'''hsa-miR-125b'''<br />
:::{| border="1" class="wikitable zebra" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!Assay!!relative expression difference (log-scale)<br />
|-<br />
| HUH Ctr vs HEK Ctr || 1,22<br />
|-<br />
| HeLa Ctr vs HEK Ctr || 1,27<br />
|-<br />
| HUH Ctr vs HeLa Ctr || -0,05<br />
|}<br />
::hsa-miR-125b is upregulated in HeLa and HUHcells, compared to HED. Comparison between HeLa and HUH shows a relatively small difference in expression level.<br />
<br /><br />
:As both miRNAs have similar relative expression levels in HUH and HeLa cells, hsa-miR-221 ist taken to test one downregulated sample<br />
<br /><br /><br />
<br />
<br />
----<br />
<br />
== 13/09/2010 ==<br />
<br /><br />
'''Restriction digest''' of psiCHECK-2 plasmid <br /><br />
This will be used as backbone for raPCR cloning. Enzymes: XhoI and NotI<br />
<br />
Assay:<br />
:5 µL 10x NEBuffer 3<br />
:5 µL 10x BSA<br />
:5 µL plasmid (psiCHECK-2, ~370 ng/µL)<br />
:3 µL XhoI<br />
:1 µL NotI<br />
:18.6 µL H<sub>2</sub>O<br />
<br />
Restriction digest was performed for approx. 5h<br />
<br />
<br /><br /><br />
'''raPCR''' to create binding sites for different miRNAs<br />
This random assembly PCR (raPCR) will be done to create binding site patterns for the miRNAs mentioned. In the first PCR step the oligos will basically anneal and constructs of different lengths will form. In the second step, the stop oligos are used as primers to amplify the previously formed constructs.<br />
<br />
* first tries are: hsa-mir-122, hsa-mir122(ran9-12) and mm-mir-376a/375 (Oligos: [[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra001-003 and ra006]])<br /><br />
<br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra017/018]])<br /><br />
spacer: raPCR_AS13-spacer(0) and raPCR_AS13-spacer(10) ([[Team:Heidelberg/Notebook/Material/Primer#Primer_Table_raPCR|ra012/013]])<br />
<br />
Oligos were used in standard conc. (100µM)<br />
<br />
*'''1. PCR'''<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
! Oligo !! mir-122 !! mir-122(ran9-12) !! mir-375/376a<br />
|-<br />
|miR || 1 or 3 µL || 1 or 3 µL || 0.5 or 1.5 µL (each)<br />
|-<br />
|spacer(0)or (10) || 1 µL || 1 µL || 1 µL<br />
|-<br />
|stop || 0 or 0.5 µL each || 0 or 0.5 µL each || 0 or 0.5 µL each<br />
|-<br />
|}<br />
<br /><br />
Total: 12 reactions<br /><br />
each reaction was set up in 30 µL, using 2x Phusion Mastermix for 12 cycles<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 12 cycles<br />
|-<br />
|57°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:45<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
*'''PCR purification:''' each PCR was purified using Qiagen PCR purification Kit and eluted in 32 µL<br /><br />
for the next PCR, three assay will tried:<br /><br />
# 5µL eluate + 1 µL of each stop oligo in 50µL total volume<br />
# 5µL eluate + 2 µL of each stop oligo in 50µL total volume<br />
# 20µL eluate + 1 µL of each stop oligo in 50µL total volume<br /><br /><br />
stop-oligos: raPCR_AS13-stop_rev_NotI and raPCR_AS13-stop_fw_XhoI<br /><br />
<br />
*'''2. PCR'''<br />
In total there were 72 reactions. Each was run with 2x Phusion Mastermix, missing volume was filled with water.<br />
<br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show;"<br />
!Temp !! Time !!<br />
|-<br />
|95°||05:00||<br />
|-<br />
|style="border-top:solid 1px #000000;"|95°||style="border-top:solid 1px #000000;border-right:solid 1px #000000;"|00:30||rowspan="3"|x 25 cycles<br />
|-<br />
|65°||style="border-right:solid 1px #000000;"|00:45<br />
|-<br />
|style="border-bottom:solid 1px #000000;"|72°||style="border-bottom:solid 1px #000000;border-right:solid 1px #000000;"|00:50<br />
|-<br />
|72°||05:00||<br />
|-<br />
|4° || forever ||<br />
|}<br />
<br />
DNA was stored in fridge afterwards<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 14/09/2010 ==<br />
<br />
The 72 PCRs from 13/10/2010 were analysed on 1% agarose gel.<br />
<br />
[[Image:2010-09-14_-_raPCR_miR375-376-klein_fertig.png|thumb|620px|center|'''raPCR using a mixture of miRBS-375 and miRBS-376a oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br /><br /><br />
<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122-klein_fertig.png|thumb|620px|center|'''raPCR using miR-122 oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
[[Image:2010-09-14_-_raPCR_miR122(ran9-12)_fertig.png|thumb|620px|center|'''raPCR using miR-122 (ran9-12) oligos''' The initial 8 PCRs from the first raPCR were purified using Qiagen PCR Purification Kit, eluted in 32 µL and used as template for the second raPCR.]]<br />
<br />
<center><br />
{| border="1" cellpadding="3" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; empty-cells:show; text-align:center; align:center;"<br />
|+ align="top, left"|'''table 1''': conditions for 1st raPCR<br />
!1. ra PCR condition!! Template-Oligo [µL] !! Stop-Oligo [µL] !! Spacer-Oligo (1µL) [bp]<br />
|-<br />
|1||1||0||0<br />
|-<br />
|2||1||0||10<br />
|-<br />
|3||1||10||0<br />
|-<br />
|4||1||10||10<br />
|-<br />
|5||3||0||0<br />
|-<br />
|6||3||0||10<br />
|-<br />
|7||3||10||0<br />
|-<br />
|8||3||10||10<br />
|}<br />
</center><br />
<br />
As we are looking for multiple binding sites, lanes with longest smear, meaning more long binding sites, were choosen for preparative gel:<br><br />
Over all assay, using 5 µL template and 1µL of each stop-oligo seem to give the best result.<br><br />
Following lanes were cut out of the gel for further cloning steps:<br />
:Spacer(0): lane 5<br />
:Spacer(10): lane 6<br />
<br />
<br />
Samples for miR122 were applied to a preparative agarose gel (1.5%). Lanes were cut out from approx. 100 to 400bp and splitted at ~250bp. Therefore, we should have small binding site patterns (between 100 and 250bp) and larger binding site patterns (betweens 250 and 400bp) with either a shorter (Spacer(0)) or longer (Spacer(10)) spacer region.<br />
<br />
<center><br />
{| style="border:none; background:transparent;"<br />
|[[Image:2010-09-14_-_raPCR_miR122_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 was cut out in the freamed region.]]||[[Image:2010-09-14_-_raPCR_miR122ran_%2B_miR375_376_prep_fertig.png|thumb|620px|center|Preparative gel for 2. raPCR of miR-122 (ran9-12) (1: Spacer(0), 2: Spacer(10)) and miR-275/376a (3: Spacer(0), 4: Spacer(10)) was cut out in the freamed region.]]<br />
|-<br />
|}</center><br />
<br />
As the gel volume was too much for dissolving in a single 2 mL tube, each part was splitted for dna extraction and brought together on the column. Gel extractions were done according to Qiagen Gel-extraction kit protocal and eluted in 30 µL water.<br />
<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 15/09/2010 ==<br />
<br />
Sample code:<br />
:Spacer(0)&nbsp;&nbsp;- 100-250bp:&nbsp;&nbsp;0S (for zero small)<br />
:Spacer(0)&nbsp;&nbsp;- 250-400bp:&nbsp;&nbsp;0L (for zero large)<br />
:Spacer(10)&nbsp;- 100-250bp:&nbsp;10S (for ten small)<br />
:Spacer(10)&nbsp;- 250-400bp:&nbsp;10L (for ten large)<br />
<br />
:this System was used for each raPCR after gel purification<br />
<br />
First row of cloning will be done with miR-122 samples. Others will follow.<br />
<br />
Samples prepared: 122-0S,-0L,-10S,-10L<br />
<br />
Gel extracted samples were digested with NotI/XhoI for cloning into psiCheck-2 vector:<br />
5µL DNA (2µL for backbone) in a total volume of 30µL using 1µL XhoI and 0.6µL NotI enzyme, for 1.5 h at 37°C.<br />
<br />
The digested DNA was then purified using Qiagen nucleotide removal kit and eluted in 30µL.<br />
<br />
Subsequently, digested fragments were ligated over night at room temperature.<br />
<br />
Ligation assay for Fermentas T4 ligase:<br />
2µL Buffer<br />
1µL Ligase<br />
7µL water<br />
1µL Backbone (6000bp, psiCHECK-2)<br />
9µL purified restriction digest<br />
<br />
<br /><br /><br /><br /><br />
<br />
----<br />
<br />
== 16/09/2010 ==<br />
<br />
Transformation of ligations:<br />
5µL ligation assay in 50µL TOP10 E.coli<br />
25 min on ice<br />
45sec heat shock on 42°C<br />
1.5-2h shaking at 37°C<br />
<br />
plated 200µL on Ampicillin-LB/Agar-Plates<br />
<br />
after incubating ~8h, at 37°C, the plates were incubated overnight at room temperature<br />
<br />
<br /><br /><br /><br /><br />
----<br />
<br />
== 17/09/2010 ==<br />
<br />
Colonies were visible in reasonable numbers on every plate<br />
<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Colony_PCR Colony PCRs] were performed to check for positive clones.<br />
<br />
Primer for colony PCR were stop-oligos, used in the raPCR. The PCR was performed in a total volume of 20 µL.<br />
<br />
One colony was dissolved in 20µL water. 5µL of this bacteria solution was used as PCR template. PCR conditions as recommended from Fermentas (see link above).<br />
From each plate, 10 colonies were picked (40 in total).<br />
<br />
Colony PCRs were then analysed on 1.5% agarose gel. Result: '''all negative'''<br />
<br />
Troubleshooting....<br />
<br />
Minipreps were prepared (5mL - LB-ampicillin) for each sample for text digestion (over night, shaking @37°C)<br />
<br />
<br /><br /><br /><br />
<br />
<br />
----<br />
<br />
== 18/09/2010 ==<br />
<br />
Plasmid DNA was purified from over night cultures using Qiagen Plasmid Miniprep Kit according to the protocol. Elution was performed in 30 µL water.<br />
<br />
Concentrations ranged from approx. 400 to 788 ng/µL.<br />
<br />
Test digestion with NotI/XhoI was performed for 1h at @37°C and analysed on an 1.5% agarose gel. No insert was visible.<br />
<br />
<br /><br /><br />
<br />
----<br />
<br />
== 19/09/2010 ==<br />
<br />
Troubleshooting: Possible Problems<br />
* we got the wrong backbone (given by Stefan M.) -> assure we have the right one<br />
* backbone was not fully digested -> several test digestions<br />
* insert was not fully digested -> can not be checked<br />
* enzymes out of function? -> single digest of the vector can check that<br />
* ligation did not work -> reaction was performed according to usual lab routine and protocol<br />
* low transformation efficiency -> reaction was performed according to usual lab routine and protocol<br />
* bacteria are not competent -> they work for other transformations<br />
<br />
Testing steps:<br />
:digestion of psiCHECK-2 given by Stefan M.<br />
:test-digestion of psiCHECK-2 given by Stefan M. again and compare both<br />
:repeat all steps<br />
<br />
Over night digestion of backbone was performed at 37°C. 0.5 µg DNA was digested with 1 µL Enzyme in NEB Buffer 3 + BSA in a total volume of 30µL<br />
<br /><br /><br />
<br />
----<br />
<br />
== 20/09/2010 ==<br />
<br />
Digestion of psiCHECK-2 plasmid was analysed on 1% agarose gel:<br />
<br />
[[Image:2010-09-20_-_psiCHECK2_digest_single_notI_xho_-fertig.png|thumb|620px|center|'''Single digest of psiCHECK-2''' Plasmid was digestet overnight @37°C with NotI/XhoI using NEB Buffer 3 + BSA in a total volume of 30µL. 1)Digest with NotI 2)Digest with XhoI 3)undigested plasmid]]<br />
<br />
Here we can see that both enzymes cut the plasmid. The linearized vector (visible at 6 kpb) in general shows up as a higher band than its undigested version, which is here visible at 4 kbp. Where the undigested plasmid shows concatemers, those are not visible after digestion, which proofs again for succesful digestion.<br />
<br />
The new digested plasmid-backbone was used for repeat of the ligation.<br />
<br /><br /><br />
<br />
----<br />
<br />
== 21/09/2010 ==<br />
<br />
Ligation was performed for 4h @25°C (1µL NotI/XhoI-linearised psiCHECK2-plasmid + 4µL digested raPCR product) using Fermentas T4 Ligase<br />
<br />
<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 28/09/2010 ==<br />
<br />
* send 1.3, 1.5, 1.7, 3.8, 3.2 for sequencing<br />
<br />
----<br />
<br />
== 29/09/2010 ==<br />
<br />
* got sequencing results of 1.3, 1.5, 1.7, 2.8, 3.2.<br />
::* 1.3 - 3 binding sites - all ok<br />
::* 1.5 - 2 binding sites - both ok<br />
::* 1.7 - 3 binding sites - all ok<br />
::* 2.8 - not ok<br />
(all those were made with Spacer(0) )<br />
::* 3.7 - 2 binding sites, created by Spacer(10) - both ok seperated by 10 nucleotide spacer<br />
<br />
----<br />
<br />
== 30/09/2010 ==<br />
<br />
* raPCRfrom above(1, 2, 3, 4)<br />
* PCR purification ( nanodrop: c ˜ 100ng/µl)<br />
* digested: 2 x 1 µg DNA: <br />
:::* EcoRI <br />
:::* PstI<br />
* gel purification (nanodrop: c ˜ 25ng/µl)<br />
* Ligation (Quick Ligase and overnight ligation with T4 ligase) into pSB1C3<br />
:::* Vector ˜ 2000 bp<br />
:::* Insert ˜ 200 bp<br />
*Transformation<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Kleinsorg