http://2010.igem.org/wiki/index.php?title=Special:Contributions/I.stansfield&feed=atom&limit=50&target=I.stansfield&year=&month=2010.igem.org - User contributions [en]2024-03-28T22:33:56ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/FACS_analysis_of_fluorescent_proteinsFACS analysis of fluorescent proteins2010-10-27T16:06:41Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<br />
<h1>'''Flow cytometry analysis of fluorescence proteins'''</h1><br />
<br />
<p style="font-size:10pt">The flow cytometer used by our team was the Becton Dickinson 'LSRII '</p><br />
<br />
Please note that as a technique, flow cytometry was used in many of our experiments although this is frequently referred to in our wiki text as FACS (Fluorescent activated cell sorting) analysis . However, we stress that in fact no cell sorting was performed in our experiments. <br />
<br />
[[Image:Adbn_FACS.jpg|center|300 px]]<br />
<br />
<br />
<p style="font-size:12pt">'''What is Flow cytometry and why do we want to use it?'''</p><br />
Flow cytometry (FCM) is a technique used for counting and examining individual microscopic particles such as cells on the basis of their fluorescence. One of its unique features is that it measures fluorescence per cell or particle, contrasting with spectrophotometry which measures absorption and transmission of wavelengths as a bulk volume of the sample.<br />
<br />
<br />
<p style="font-size:12pt">'''How does the flow cytometry work?'''</p> <br />
The sample is injected into the center of the sheath stream of flow cytometer in a liquid state; therefore the particles are distributed randomly. The fluidics system is then responsible for separating out the particles into an ordered stream of single particles.<br />
<br />
<br />
<br />
[[Image:FACS_FC.jpg|center|450 px]]<br />
<br />
<br />
<br />
After hydrodynamic focusing, the cells or particles of interest pass through the laser beam therefore intercepting and scattering the light which excites the fluorochromes to a higher energy state. The energy is then released as a photon of light with spectral properties unique to specific fluorochromes. Light scattered in the forward direction (as shown in the below diagram) is collected by a lens which is in line with the beam known as the forward scatter channel (FSC). The FSC intensity gives the particles size and can give information used to distinguish between cellular debris and living cells. The side scatter channel (SSC) is perpendicular to the beam and provides information about the granular content within a particle. Both FSC and SSC are unique for each particle and a combination of the two may be used to differentiate between different cell types in a heterogeneous sample. <br />
<br />
[[Image:Fsc.ssc.JPG|center|600 px]]<br />
<br />
<p style="font-size:12pt">'''What is cell sorting?'''</p><br />
Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry. The rate of flow sorting at 10 000 cells/second provides a method for sorting a heterogeneous mixture of biological cells into separate storage containers. It is based upon the specific light scattering and fluorescent characteristics of each cell. It is an extremely useful scientific instrument, as it provides fast, objective and quantitative recording of fluorescent signals from individual cells as well as physical separation of cells of particular interest.<br />
<br />
<br />
<p style="font-size:12pt">'''How does cell sorting work?'''</p><br />
After the cells have passed through the laser beam and the detectors, a vibrating mechanism causes the stream of cells to break into individual droplets. An electrical charge is placed at the point where the stream breaks into droplets immediately prior to the fluorescence intensity measurement, and the opposite charge is trapped on the droplet as it breaks from the stream. The droplets then travel through a strong electrostatic field and are deflected based on their charge into waiting sample tubes. The number of cells and level of fluorescence in each tube is then known.<br />
<br />
<br />
<p style="font-size:12pt">'''Things we had to consider for our project when using the Flow cytometry.''' </p><br />
During our experiment our choice of fluorochrome was restricted by the possibility of spectral overlap. When two or more fluorochromes are used during a single experiment there is a chance that their emission profiles will coincide, making measurement of the true fluorescence emitted by each particle very difficult. Therefore careful consideration of the excitation and emission wavelengths of the Green Fluorescent Protein and the Cyan Fluorescent Protein was carried out prior to the experiment to ensure there was no overlap.<br />
<br />
<br />
<p style="font-size:12pt">'''What data did we take from the Flow Cytometry and what does it tell us?'''</p> <br />
The graph shown below is an example of a single-parameter histogram obtained from the FACS during our experiment. These graphs display a single measurement parameter; the relative fluorescence (as shown above) or light scatter intensity on the x-axis and the number of events (cell count) on the y-axis. This graph is very useful for evaluating the total number of cells in a sample that have the physical properties selected for or which express the marker of interest (as is the case with our project). The graph involves flow analysis on a mixed population of cells (some expressing GFP and some are not) this results in several peaks on the histogram. In order to identify the positive dataset, a positive and a negative control is used for positive identification of the peak corresponding to the cells which were and which were not expressing GFP.<br />
<br />
<br />
[[Image:Ka1.JPG|center|450 px]]<br />
<br />
<br />
Below is an example of a density plot taken during one of our experiments. In this plot, the particle counts are shown by dot density. Each cell recorded i.e. one of the dots shown above, is referred to as an event. The green colour represents larger number of events and the red one even more. The different colours are used to create a three-dimensional feel.<br />
<br />
<br />
[[Image:Ka2.JPG|center|450 px]]<br />
<br />
<br />
In preparation of the Flow cytometry analysis we;<br />
<br />
1. Washed and resuspended samples in PBS at a density of 10^5-10^7 cells/ml.<br><br />
2. Less than 1 ml was required for analysis and cells were stored on ice until analysed then vortexed before analysed.</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/PartsTeam:Aberdeen Scotland/Parts2010-10-27T15:57:48Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Parts Submitted to the Registry</h1><br />
</html><br />
<br />
== '''[http://partsregistry.org/Part:BBa_K385002 Part:BBa_K385002]: Phage MS2 coat protein''' ==<br />
<br />
'''Length''': 414 bp<br />
<br />
'''Part type''': coding<br />
<br />
<br />
'''Part information'''<br />
<br />
This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.<br />
<br />
<br />
'''Sequence'''<br />
<br />
Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg<br />
tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc<br />
caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac<br />
<br />
<br />
'''Design Notes'''<br />
<br />
We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)<br />
<br />
<br />
'''Source '''<br />
[http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]<br />
<br />
== '''[http://partsregistry.org/Part:BBa_K385003 Part:BBa_K385003]: Phage lambda N-peptide ==<br />
<br />
'''Length''': 90 bp<br />
<br />
'''Part type''': coding<br />
<br />
<br />
'''Part information'''<br />
<br />
N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.<br />
<br />
<br />
'''Sequence'''<br />
<br />
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac<br />
<br />
<br />
'''Applications'''<br />
<br />
The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.<br />
<br />
<br />
'''Design Notes'''<br />
<br />
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC) <br />
<br />
<br />
'''Source '''<br />
Phage lambda genome<br />
<br />
== '''[http://partsregistry.org/Part:BBa_K385004 Part:BBa_K385004]: Phage lambda N-peptide, tandem repeat ==<br />
<br />
'''Length''': 177 bp<br />
<br />
'''Part type''': coding<br />
<br />
<br />
'''Part information'''<br />
<br />
Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa%20K385004 confirmed sequence]<br />
<br />
<br />
'''Sequence'''<br />
<br />
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa<br />
cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat<br />
<br />
<br />
'''Applications'''<br />
<br />
The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415. <br />
The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1). <br />
<br />
[[Image:PRS415_FLU.jpg|center|800 px]]<br />
<br />
A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence. <br />
Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.<br />
<br />
<br />
'''Design Notes'''<br />
<br />
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC) <br />
<br />
'''Source '''<br />
Phage lambda genome<br />
<br />
== '''[http://partsregistry.org/Part:BBa_K385005 Part:BBa_K385005]: B-box sequence encoding a regulatory mRNA stem loop ==<br />
<br />
'''Length''': 56 bp<br />
<br />
'''Part type''': Regulatory <br />
<br />
<br />
'''Part information'''<br />
<br />
This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR. <br />
<br />
<br />
'''Sequence'''<br />
<br />
attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat<br />
<br />
<br />
'''Source '''<br />
Phage lambda genome<br />
<html><br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Modeling">Continue to the Modelling Summary&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/BioBrick_ConstructionBioBrick Construction2010-10-26T19:31:58Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>BioBrick construction</h1><br />
<br />
<h3>Introduction</h3><br />
<br />
<p>For the iGEM 2010 project one of the team's aim was to contribute to the iGEM community via the testing and building of Bio-brick parts using standard plasmid parts. Here, we outline the process we used to construct Biobricks that were submitted to the Registry of Parts. The process consists of three steps: vector preparation (its purification and digestion), insert preparation (its amplification and digestion) and the final ligation step.</p><br />
<p> <br><br />
For the first step, plasmid pSB1C3 was chosen. It is a high copy BioBrick assembly plasmid (2072 bp) compatible with assembly standard 10.</p><br><br />
<p><br />
We have successfully ligated four components of the toggle switch "AyeSwitch" to the pSB1C3 plasmid: Phage MS2 coat protein, Phage lambda N-peptide (and a tandem N-peptide variant) as well as B-box sequence encoding a regulatory mRNA stem loop.<br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Parts"><i>Parts Submitted to Registry of Parts</i></a></p><br />
<br />
<h3>Protocol</h3><br />
<br />
<h3>Vector Preparation </h3><br />
<p><br />
Construction plasmid: pSB1C3(High Copy BioBrick assembly plasmid) was provided by iGEM HQ as a PCR-amplified linear piece of DNA<br />
<br><br />
1) The linear vector preparation was cut with EcoRI and PstI restriction enzymes<br />
<br><br />
2) Cut vector was electrophoresed on an agarose gel to estimate size, quality and quantity (the latter in comparison to known amounts of molecular mass DNA ladders)<br />
<br><br />
<p><br />
4) Restriction enzymes heat inactivation – 20 min at 65°C then pulse spin<br />
<br><br />
5) In a normal ligation, at this point the vector would be treated with alkaline phosphatase to remove the 5’ phosphate groups and prevent self ligation. However, with linear, PCR amplified vector as the starting material this was not necessary; from the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones Registry of Parts"<i> Registry of Parts;</i></a></p><br> <i>Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. </i><br />
<br><br><br />
RESULT: purified plasmid backbone with EcoRI and PstI cohesive ends<br />
</p><br />
<br />
<h3> Insert Preparation </h3><br />
<p><br />
Selected part of the AyeSwitch such as MS2 coat protein.<br />
<br><br />
<br />
1) PCR reaction to amplify the desired fragment for BioBrick construct i.e. MS2 coat protein from<br />
CUP1p - [MS2-CFP] plasmid (template) + forward and reverse primers of MS2 coat protein<br />
<br><br />
<br />
2) Gel electrophoresis to assess whether desired fragment was amplified and to determine its concentration.<br />
<br><br />
<br />
3) Digestion with restriction enzymes (EcoRI and PstI) to generate sticky ends<br />
<br><br />
<br />
4) Restriction enzymes heat inactivation - 20 min at 65°C then pulse spin.<br />
<br><br><br />
<br />
RESULT: purified selected insert with EcoRI and PstI cohesive ends.<br />
</p><br />
<br />
<h3> Ligation Reaction </h3><br />
<p><br />
Vector + selected insert<br />
<br><br />
1) Ligation in the molar ration of 1:3 (vector : insert).<br />
<br><br />
Including a number of controls:<br />
a) vector alone (control for uncut vector presence)<br />
b) vector alone + ligase (control for unsuccessful alkaline phosphatase treatment)<br />
c) insert alone (control for template presence i.e. CUP1p - [MS2-CFP])<br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/e/e7/Biobrickplasmidtable.png"/></td></tr></center><br />
<br><br><br />
2) The ligation mix is then transformed into E. coli competent cells and grown overnight in LB plates + Chloramphenicol. It would be expected to see E. coli growing colonies only on vector backbone + insert plates.<br />
<br><br />
3) PCR of E. coli colonies to amplify chosen fragment after successful ligation.<br />
<br><br />
4) Gel electrophoresis to verify the lengths of fragments after successful ligation.<br />
<br><br />
5) Getting DNA sequenced – final verification.<br />
<br><br />
6) BioBrick submission.<br />
</p><br />
<br><br><br />
<br />
</html><br />
<br />
<html><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td align="center"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/BioBrick_ConstructionBioBrick Construction2010-10-26T19:31:17Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>BioBrick construction</h1><br />
<br />
<h3>Introduction</h3><br />
<br />
<p>For the iGEM 2010 project one of the team's aim was to contribute to the iGEM community via the testing and building of Bio-brick parts using standard plasmid parts. Here, we outline the process we used to construct Biobricks that were submitted to the Registry of Parts. The process consists of three steps: vector preparation (its purification and digestion), insert preparation (its amplification and digestion) and the final ligation step.</p><br />
<p> <br><br />
For the first step, plasmid pSB1C3 was chosen. It is a high copy BioBrick assembly plasmid (2072 bp) compatible with assembly standard 10.</p><br><br />
<p><br />
We have successfully ligated four components of the toggle switch "AyeSwitch" to the pSB1C3 plasmid: Phage MS2 coat protein, Phage lambda N-peptide (and a tandem N-peptide variant) as well as B-box sequence encoding a regulatory mRNA stem loop.<br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Parts"><i>Parts Submitted to Registry of Parts</i></a></p><br />
<br />
<h3>Protocol</h3><br />
<br />
<h3>Vector Preparation </h3><br />
<p><br />
Construction plasmid: pSB1C3(High Copy BioBrick assembly plasmid) was provided by iGEM HQ as a PCR-amplified linear piece of DNA<br />
<br><br />
1) The linear vector preparation was cut with EcoRI and PstI restriction enzymes<br />
<br><br />
2) Cut vector was electrophoresed on an agarose gel to estimate size, quality and quantity (the latter in comparison to known amounts of molecular mass DNA ladders)<br />
<br><br />
</p><br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/a/a8/Biobrickplasmid.png"/></td></tr></center><br />
<br><br><br />
<br />
<p><br />
<br><br />
4) Restriction enzymes heat inactivation – 20 min at 65°C then pulse spin<br />
<br><br />
5) In a normal ligation, at this point the vector would be treated with alkaline phosphatase to remove the 5’ phosphate groups and prevent self ligation. However, with linear, PCR amplified vector as the starting material this was not necessary; from the <a href="http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones Registry of Parts"<i> Registry of Parts;</i></a></p><br> <i>Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. </i><br />
<br><br><br />
RESULT: purified plasmid backbone with EcoRI and PstI cohesive ends<br />
</p><br />
<br />
<h3> Insert Preparation </h3><br />
<p><br />
Selected part of the AyeSwitch such as MS2 coat protein.<br />
<br><br />
<br />
1) PCR reaction to amplify the desired fragment for BioBrick construct i.e. MS2 coat protein from<br />
CUP1p - [MS2-CFP] plasmid (template) + forward and reverse primers of MS2 coat protein<br />
<br><br />
<br />
2) Gel electrophoresis to assess whether desired fragment was amplified and to determine its concentration.<br />
<br><br />
<br />
3) Digestion with restriction enzymes (EcoRI and PstI) to generate sticky ends<br />
<br><br />
<br />
4) Restriction enzymes heat inactivation - 20 min at 65°C then pulse spin.<br />
<br><br><br />
<br />
RESULT: purified selected insert with EcoRI and PstI cohesive ends.<br />
</p><br />
<br />
<h3> Ligation Reaction </h3><br />
<p><br />
Vector + selected insert<br />
<br><br />
1) Ligation in the molar ration of 1:3 (vector : insert).<br />
<br><br />
Including a number of controls:<br />
a) vector alone (control for uncut vector presence)<br />
b) vector alone + ligase (control for unsuccessful alkaline phosphatase treatment)<br />
c) insert alone (control for template presence i.e. CUP1p - [MS2-CFP])<br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/e/e7/Biobrickplasmidtable.png"/></td></tr></center><br />
<br><br><br />
2) The ligation mix is then transformed into E. coli competent cells and grown overnight in LB plates + Chloramphenicol. It would be expected to see E. coli growing colonies only on vector backbone + insert plates.<br />
<br><br />
3) PCR of E. coli colonies to amplify chosen fragment after successful ligation.<br />
<br><br />
4) Gel electrophoresis to verify the lengths of fragments after successful ligation.<br />
<br><br />
5) Getting DNA sequenced – final verification.<br />
<br><br />
6) BioBrick submission.<br />
</p><br />
<br><br><br />
<br />
</html><br />
<br />
<html><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td align="center"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/BioBrick_ConstructionBioBrick Construction2010-10-26T19:26:28Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>BioBrick construction</h1><br />
<br />
<h3>Introduction</h3><br />
<br />
<p>For the iGEM 2010 project one of the team's aim was to contribute to the iGEM community via the testing and building of Bio-brick parts using standard plasmid parts. Here, we outline the process we used to construct Biobricks that were submitted to the Registry of Parts. The process consists of three steps: vector preparation (its purification and digestion), insert preparation (its amplification and digestion) and the final ligation step.</p><br />
<p> <br><br />
For the first step, plasmid pSB1C3 was chosen. It is a high copy BioBrick assembly plasmid (2072 bp) compatible with assembly standard 10.</p><br><br />
<p><br />
We have successfully ligated four components of the toggle switch "AyeSwitch" to the pSB1C3 plasmid: Phage MS2 coat protein, Phage lambda N-peptide (and a tandem N-peptide variant) as well as B-box sequence encoding a regulatory mRNA stem loop.<br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Parts"><i>Parts Submitted to Registry of Parts</i></a></p><br />
<br />
<h3>Protocol</h3><br />
<br />
<h3>Vector Preparation </h3><br />
<p><br />
Construction plasmid: pSB1C3(High Copy BioBrick assembly plasmid) was provided by iGEM HQ as a PCR-amplified linear piece of DNA<br />
<br><br />
1) The linear vector preparation was cut with EcoRI and PstI restriction enzymes<br />
<br><br />
2) Cut vector was electrophoresed on an agarose gel to estimate size, quality and quantity (the latter in comparison to known amounts of molecular mass DNA ladders)<br />
<br><br />
</p><br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/a/a8/Biobrickplasmid.png"/></td></tr></center><br />
<br><br><br />
<br />
<p><br />
<br><br />
4) Restriction enzymes heat inactivation – 20 min at 65°C then pulse spin<br />
<br><br />
5) In a normal ligation, at this point the vector would be treated with alkaline phosphatase to remove the 5’ phosphate groups and prevent self ligation. However, with linear, PCR amplified vector as the starting material this was not necessary; from the<a>"http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones Registry of Parts"</a>; <i>Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. </i><br />
<br><br><br />
RESULT: purified plasmid backbone with EcoRI and PstI cohesive ends, without 5’ phosphate groups<br />
</p><br />
<br />
<h3> Insert Preparation </h3><br />
<p><br />
Selected part of the AyeSwitch such as MS2 coat protein.<br />
<br><br />
<br />
1) PCR reaction to amplify the desired fragment for BioBrick construct i.e. MS2 coat protein from<br />
CUP1p - [MS2-CFP] plasmid (template) + forward and reverse primers of MS2 coat protein<br />
<br><br />
<br />
2) Gel electrophoresis to assess whether desired fragment was amplified and to determine its concentration.<br />
<br><br />
<br />
3) Digestion with restriction enzymes (EcoRI and PstI) to generate sticky ends<br />
<br><br />
<br />
4) Restriction enzymes heat inactivation - 20 min at 65°C then pulse spin.<br />
<br><br><br />
<br />
RESULT: purified selected insert with EcoRI and PstI cohesive ends.<br />
</p><br />
<br />
<h3> Ligation Reaction </h3><br />
<p><br />
Vector + selected insert<br />
<br><br />
1) Ligation in the molar ration of 1:3 (vector : insert).<br />
<br><br />
Including a number of controls:<br />
a) vector alone (control for uncut vector presence)<br />
b) vector alone + ligase (control for unsuccessful alkaline phosphatase treatment)<br />
c) insert alone (control for template presence i.e. CUP1p - [MS2-CFP])<br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/e/e7/Biobrickplasmidtable.png"/></td></tr></center><br />
<br><br><br />
2) The ligation mix is then transformed into E. coli competent cells and grown overnight in LB plates + Chloramphenicol. It would be expected to see E. coli growing colonies only on vector backbone + insert plates.<br />
<br><br />
3) PCR of E. coli colonies to amplify chosen fragment after successful ligation.<br />
<br><br />
4) Gel electrophoresis to verify the lengths of fragments after successful ligation.<br />
<br><br />
5) Getting DNA sequenced – final verification.<br />
<br><br />
6) BioBrick submission.<br />
</p><br />
<br><br><br />
<br />
</html><br />
<br />
<html><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td align="center"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/BioBrick_ConstructionBioBrick Construction2010-10-26T19:11:40Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>BioBrick construction</h1><br />
<br />
<h3>Introduction</h3><br />
<br />
<p>For the iGEM 2010 project one of the team's aim was to contribute to the iGEM community via the testing and building of Bio-brick parts using standard plasmid parts. Here, we outline the process we used to construct Biobricks that were submitted to the Registry of Parts. The process consists of three steps: vector preparation (its purification and digestion), insert preparation (its amplification and digestion) and the final ligation step.</p><br />
<p> <br><br />
For the first step, plasmid pSB1C3 was chosen. It is a high copy BioBrick assembly plasmid (2072 bp) compatible with assembly standard 10.</p><br><br />
<p><br />
We have successfully ligated four components of the toggle switch "AyeSwitch" to the pSB1C3 plasmid: Phage MS2 coat protein, Phage lambda N-peptide (and a tandem N-peptide variant) as well as B-box sequence encoding a regulatory mRNA stem loop.<br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Parts"><i>Parts Submitted to Registry of Parts</i></a></p><br />
<br />
<h3>Protocol</h3><br />
<br />
<h3>Vector Preparation </h3><br />
<p><br />
Construction plasmid: pSB1C3(High Copy BioBrick assembly plasmid) was provided by iGEM HQ as a PCR-amplified linear piece of DNA<br />
<br><br />
1) The linear vector preparation was cut with EcoRI and PstI restriction enzymes<br />
<br><br />
2) Cut vector was electrophoresed on an agarose gel to estimate size, quality and quantity (the latter in comparison to known amounts of molecular mass DNA ladders)<br />
<br><br />
</p><br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/a/a8/Biobrickplasmid.png"/></td></tr></center><br />
<br><br><br />
<br />
<p><br />
<br><br />
4) Restriction enzymes heat inactivation – 20 min at 65°C then pulse spin<br />
<br><br />
5) Alkaline phosphatase treatment – to remove the 5’ phosphate groups to prevent self ligation. Follow the protocol for “Antarctic Phosphatase”.<br />
<br><br />
6) Alkaline phosphatase heat inactivation. <br />
<br><br><br />
RESULT: purified plasmid backbone with EcoRI and PstI cohesive ends, without 5’ phosphate groups<br />
</p><br />
<br />
<h3> Insert Preparation </h3><br />
<p><br />
Selected part of the AyeSwitch such as MS2 coat protein.<br />
<br><br />
<br />
1) PCR reaction to amplify the desired fragment for BioBrick construct i.e. MS2 coat protein from<br />
CUP1p - [MS2-CFP] plasmid (template) + forward and reverse primers of MS2 coat protein<br />
<br><br />
<br />
2) Gel electrophoresis to assess whether desired fragment was amplified and to determine its concentration.<br />
<br><br />
<br />
3) Digestion with restriction enzymes (EcoRI and PstI) to generate sticky ends<br />
<br><br />
<br />
4) Restriction enzymes heat inactivation - 20 min at 65°C then pulse spin.<br />
<br><br><br />
<br />
RESULT: purified selected insert with EcoRI and PstI cohesive ends.<br />
</p><br />
<br />
<h3> Ligation Reaction </h3><br />
<p><br />
Vector + selected insert<br />
<br><br />
1) Ligation in the molar ration of 1:3 (vector : insert).<br />
<br><br />
Including a number of controls:<br />
a) vector alone (control for uncut vector presence)<br />
b) vector alone + ligase (control for unsuccessful alkaline phosphatase treatment)<br />
c) insert alone (control for template presence i.e. CUP1p - [MS2-CFP])<br />
<br><br />
<br><br />
<center><img src="https://static.igem.org/mediawiki/2010/e/e7/Biobrickplasmidtable.png"/></td></tr></center><br />
<br><br><br />
2) The ligation mix is then transformed into E. coli competent cells and grown overnight in LB plates + Chloramphenicol. It would be expected to see E. coli growing colonies only on vector backbone + insert plates.<br />
<br><br />
3) PCR of E. coli colonies to amplify chosen fragment after successful ligation.<br />
<br><br />
4) Gel electrophoresis to verify the lengths of fragments after successful ligation.<br />
<br><br />
5) Getting DNA sequenced – final verification.<br />
<br><br />
6) BioBrick submission.<br />
</p><br />
<br><br><br />
<br />
</html><br />
<br />
<html><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td align="center"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/ResultsTeam:Aberdeen Scotland/Results2010-10-25T21:16:44Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Main Experimental Results</h1><br />
<br />
<h2>1.Promoter characterisation</h2><br />
<br />
<h4>(a) Characterising the CUP1 promoter induction characteristics</h4><br />
<p><br />
Here, we successfully characterised the induction characteristics of the CUP1 promoter using construct CUP1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_the_CUP1_Promoter_Using_N4"><i>Timed Induction of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>Copper Dose Response of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<br><br />
<br />
<h4> b) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br><br />
<br />
<br />
<h2>2.Switch characterisation</h2><br />
<br />
<h4> (a) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>In these experiments, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (b) Measuring the GAL1 promoter dose-responsiveness characteristics </h4><br />
<p>Here, we successfully characterised the dose response characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (c) Quantifying the expression of MS2-CFP from the construct CUP1p-[MS2-CFP]</h4><br />
<p>This experiment identified the failure of the CUP1p-[MS2-CFP] construct to direct expression of the fusion protein at significant level, using a variety of analytical techniques to show that CFP expression was undetectable under a range of conditions</p><br />
<p><a href="https://2010.igem.org/1._Confirmation_using_microscope_and_fluorometer_analysis_that_the_pRS414_construct_was_not_expressing_CFP"><i>Confirmation that CUP1p-[MS2-CFP] did not express CFP</i></a></p><br />
<br><br />
<br />
<h4> (d) Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein.</h4><br />
<p>In these experiments, we used <i>trans</i> expression of the MS2 protein to show that the MS2 stem loops that formed part of the 5’ leader of the GAL1p-[Npeptide-GFP] mRNA were successfully recognised by the MS2 RNA binding protein, to cause translation repression of N-pep-GFP expression, validating our RNA stem loop-based translational control approach. </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expresion on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br />
<br />
<h4> (e) Measuring the decay characteristics of GFP following a switch to non-inducing conditions using GAL1p-[Npeptide-GFP].</h4><br />
<p>In these experiments, a culture grown on galactose, and expressing GFP, was switched to glucose to repress GFP expresion, and the decay profile of GFP measured. The experiment revealed that GFP was extremely stable, and decay was primarily due to dilution through culture growth </p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/GFP_decay"><i>The decay characteristics of GFP following promoter switch-off</i></a></p><br />
<br><br><br />
<br />
<h2>3.Switch troubleshooting</h2><br />
<h4> (a) Cassette replacement experiment – promoter </h4> <br />
<p>Here we used homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a previoulsy tested and functioning CUP1 promoter with 5' untranslated leader sequence <a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>CUP1 Characterisation in CUP1p-GFP</i></a> and determined that the promoter was not the faulty component in CUP1p-[MS2-CFP].</p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a CUP1 promoter plus 5' untranslated leader sequence </i></a></p><br />
<br><br />
<br />
<h4> (b) Cassette replacement experiment – fluorescent protein </h4><br />
<p>Here we replaced the GFP sequence in TEF1p -[GFP] which constitutively expresses GFP with the CFP sequence from CUP1p-[MS2-CFP] and determined that the CFP sequence was expressed properly and therefore functioning correctly. </p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CFP fluorescent protein in CUP1p-[MS2-CFP] with a GFP replacement variant </i></a></p><br />
<br><br><br />
<br />
<br />
<h2>4. Other Biobrick testing </h2><br />
<h4> mOrange experiments </h4><br />
<p>In these experiments, we tested the Biobrick E2050 mOrange from the Registry of Parts and confirmed that within our gene cassette,GAL1p-[Npep-GFP]this Biobrick part did not function as expected. </p><br />
<p><a href="https://2010.igem.org/Homologous_Recombination_of_E2050_into_pRS415_Construct_in_Place_of_GFP_Protein"><i>Homologous Recombination of E2050 into GAL1p-[Npep-GFP] Construct in Place of GFP Protein </i></a></p><br />
<p><br />
<a href="https://2010.igem.org/FACS_Analysis_of_mOrange_recombinant_pRS415"><i>FACS analysis of mOrange expression under Gal1 promoter control in GAL1p-[Npep-mOrange]</i></a></p><br />
<br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Constructs"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to DNA Constructs</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols">Continue to Protocols&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
<br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T21:15:56Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing between 0.02% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose (see panel B below, compare blue symbols [glucose] with red symbols [raffinose]).<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<br><br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T21:15:35Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing between 0.02% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose (see panel B below, compare blue symbols [glucose] with red symbols [raffinose]).<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T21:15:14Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing between 0.02% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose (see panel B below, compare red symbols [glucose] with blue symbols [raffinose]).<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T21:09:09Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the glucose repression of GAL1 promoter in the GAL1p-[Npeptide-GFP] construct </h1><br />
<br />
<h3>Aim</h3><br />
<p>To test the effect of glucose on repression of the GAL1 promoter, and thus on shut-off of GFP expression from construct GAL1p-[Npeptide-GFP] construct over time.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>The presence of glucose should quickly repress the GAL1 promoter and therefore result in the overall reduction of the GFP intensity present within the cells; measurement of the rate of decay should identify the relative stability of the GFP protein</p><br />
<br />
<h3>Protocol</h3><br />
<p>1. Yeast transformed with the GAL1p-[Npeptide-GFP] construct were innoculated overnight in 5 mls of synthetic defined medium with amino acids; his (0.2 %), met (0.2%), ura (0.2%), trp (0.2 %) and Raffinose (2 %) as the carbon source.<br><br><br />
2. Following overnight growth the cells were subcultured in fresh, pre-warmed SD medium (50 mls) containing galactose (a range of concentrations: see Results below) to obtain a predicted OD600 of 0.3 by 10 am the following morning.<br><br><br />
3. The following morning, at an OD600 of 0.3, a sample (1 ml) was taken before and after the addition of glucose (2 %). Samples were then taken every 20 minutes thereafter for a period of 167 minutes. All samples were then pelleted (13000 rpm, 5 mins, 4 degreesC), washed once with PBS buffer and stored on ice. Once collected all samples were then dispenced in PBS and diuted by a factor of 1/20 for FACS analysis.<br />
</p><br><br />
<br />
<h3>Results</h3><br />
Cells grown on galactose and expressing GFP were switched to growth on medium containing glucose. Following the resultant switch-off of the GAL1 promoter, GFP decay was monitored.<br><br><br />
Panel A (below) shows FACS analysis, with the peak to the left indicating GFP expressing cells and a peak to the right showing non GFP expressing cells. The FACS analysis clearly shows that the highest GFP expression (bottom light blue line) is observed after incubation overnight with galactose, with glucose present. It can be observed that after the addition of glucose (all lines above the blue) that there is a continuous increase in the number of cells not expressing GFP over time.<br><br><br />
Panel B shows this data in summarised, averaged form. It reveals that the average GFP intensity of the cells decreased steadily with time after the glucose addition, hence showing that the glucose has rapidly repressed the GAL1 promoter,and inhibited the expression of GFP. The half-life of this decay was approximately 140 minutes, which corresponded to approximately the doubling time of the cell culture, indicating that cell division was the primary reason for GFP disappearance, rather than active GFP turnover.<br />
<br />
<br><br><br />
<center><br />
[[Image: glu-repression.jpg|500 px]]<br />
</center><br />
<br />
<h3>Conclusion</h3><br />
The presence of glucose rapidly inhibits the GAL1 promoter from expressing GFP and the average GFP intensity within a cell reduces by over 50 % within 140 minutes, consistent with cell division being the primary source of GFP depletion. This confirmed the fact that GFP is widely considered to be an extremely stable protein.<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T21:04:51Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<br />
<h3>Aim</h3><br />
<p>To test the effect of glucose on repression of the GAL1 promoter, and thus on shut-off of GFP expression from construct GAL1p-[Npeptide-GFP] construct over time.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>The presence of glucose should quickly repress the GAL1 promoter and therefore result in the overall reduction of the GFP intensity present within the cells; measurement of the rate of decay should identify the relative stability of the GFP protein</p><br />
<br />
<h3>Protocol</h3><br />
<p>1. Yeast transformed with the GAL1p-[Npeptide-GFP] construct were innoculated overnight in 5 mls of synthetic defined medium with amino acids; his (0.2 %), met (0.2%), ura (0.2%), trp (0.2 %) and Raffinose (2 %) as the carbon source.<br><br><br />
2. Following overnight growth the cells were subcultured in fresh, pre-warmed SD medium (50 mls) containing galactose (a range of concentrations: see Results below) to obtain a predicted OD600 of 0.3 by 10 am the following morning.<br><br><br />
3. The following morning, at an OD600 of 0.3, a sample (1 ml) was taken before and after the addition of glucose (2 %). Samples were then taken every 20 minutes thereafter for a period of 167 minutes. All samples were then pelleted (13000 rpm, 5 mins, 4 degreesC), washed once with PBS buffer and stored on ice. Once collected all samples were then dispenced in PBS and diuted by a factor of 1/20 for FACS analysis.<br />
</p><br><br />
<br />
<h3>Results</h3><br />
Cells grown on galactose and expressing GFP were switched to growth on medium containing glucose. Following the resultant switch-off of the GAL1 promoter, GFP decay was monitored.<br><br><br />
Panel A (below) shows FACS analysis, with the peak to the left indicating GFP expressing cells and a peak to the right showing non GFP expressing cells. The FACS analysis clearly shows that the highest GFP expression (bottom light blue line) is observed after incubation overnight with galactose, with glucose present. It can be observed that after the addition of glucose (all lines above the blue) that there is a continuous increase in the number of cells not expressing GFP over time.<br><br><br />
Panel B shows this data in summarised, averaged form. It reveals that the average GFP intensity of the cells decreased steadily with time after the glucose addition, hence showing that the glucose has rapidly repressed the GAL1 promoter,and inhibited the expression of GFP. The half-life of this decay was approximately 140 minutes, which corresponded to approximately the doubling time of the cell culture, indicating that cell division was the primary reason for GFP disappearance, rather than active GFP turnover.<br />
<br />
<br><br><br />
<center><br />
[[Image: glu-repression.jpg|500 px]]<br />
</center><br />
<br />
<h3>Conclusion</h3><br />
The presence of glucose rapidly inhibits the GAL1 promoter from expressing GFP and the average GFP intensity within a cell reduces by over 50 % within 140 minutes, consistent with cell division being the primary source of GFP depletion. This confirmed the fact that GFP is widely considered to be an extremely stable protein.<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T21:03:39Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<br />
<h3>Aim</h3><br />
<p>To test the effect of glucose on repression of the GAL1 promoter, and thus on shut-off of GFP expression from construct GAL1p-[Npeptide-GFP] construct over time.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>The presence of glucose should quickly repress the GAL1 promoter and therefore result in the overall reduction of the GFP intensity present within the cells; measurement of the rate of decay should identify the relative stability of the GFP protein</p><br />
<br />
<h3>Protocol</h3><br />
<p>1. Yeast transformed with the GAL1p-[Npeptide-GFP] construct were innoculated overnight in 5 mls of synthetic defined medium with amino acids; his (0.2 %), met (0.2%), ura (0.2%), trp (0.2 %) and Raffinose (2 %) as the carbon source.<br />
2. Following overnight growth the cells were subcultured in fresh, pre-warmed SD medium (50 mls) containing galactose (a range of concentrations: see Results below) to obtain a predicted OD600 of 0.3 by 10 am the following morning.<br />
3. The following morning, at an OD600 of 0.3, a sample (1 ml) was taken before and after the addition of glucose (2 %). Samples were then taken every 20 minutes thereafter for a period of 167 minutes. All samples were then pelleted (13000 rpm, 5 mins, 4 degreesC), washed once with PBS buffer and stored on ice. Once collected all samples were then dispenced in PBS and diuted by a factor of 1/20 for FACS analysis.<br />
</p><br><br />
<br />
<h3>Results</h3><br />
Cells grown on galactose and expressing GFP were switched to growth on medium containing glucose. Following the resultant switch-off of the GAL1 promoter, GFP decay was monitored.<br><br />
Panel A (below) shows FACS analysis, with the peak to the left indicating GFP expressing cells and a peak to the right showing non GFP expressing cells. The FACS analysis clearly shows that the highest GFP expression (bottom light blue line) is observed after incubation overnight with galactose, with glucose present. It can be observed that after the addition of glucose (all lines above the blue) that there is a continuous increase in the number of cells not expressing GFP over time.<br><br />
Panel B shows this data in summarised, averaged form. It reveals that the average GFP intensity of the cells decreased steadily with time after the glucose addition, hence showing that the glucose has rapidly repressed the GAL1 promoter,and inhibited the expression of GFP. The half-life of this decay was approximately 140 minutes, which corresponded to approximately the doubling time of the cell culture, indicating that cell division was the primary reason for GFP disappearance, rather than active GFP turnover.<br />
<br />
<br><br />
<center><br />
[[Image: glu-repression.jpg|500 px]]<br />
</center><br />
<br />
<h3>Conclusion</h3><br />
The presence of glucose rapidly inhibits the GAL1 promoter from expressing GFP and the average GFP intensity within a cell reduces by over 50 % within 140 minutes, consistent with cell division being the primary source of GFP depletion. This confirmed the fact that GFP is widely considered to be an extremely stable protein.<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T20:56:16Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<br />
<h3>Aim</h3><br />
<p>To test the effect of glucose on repression of the GAL1 promoter, and thus on shut-off of GFP expression from construct GAL1p-[Npeptide-GFP] construct over time.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>The presence of glucose should quickly repress the GAL1 promoter and therefore result in the overall reduction of the GFP intensity present within the cells; measurement of the rate of decay should identify the relative stability of the GFP protein</p><br />
<br />
<h3>Protocol</h3><br />
<p>1. Yeast transformed with the GAL1p-[Npeptide-GFP] construct were innoculated overnight in 5 mls of synthetic defined medium with amino acids; his (0.2 %), met (0.2%), ura (0.2%), trp (0.2 %) and Raffinose (2 %) as the carbon source.<br />
2. Following overnight growth the cells were subcultured in fresh, pre-warmed SD medium (50 mls) containing galactose (a range of concentrations: see Results below) to obtain a predicted OD600 of 0.3 by 10 am the following morning.<br />
3. The following morning, at an OD600 of 0.3, a sample (1 ml) was taken before and after the addition of glucose (2 %). Samples were then taken every 20 minutes thereafter for a period of 167 minutes. All samples were then pelleted (13000 rpm, 5 mins, 4 degreesC), washed once with PBS buffer and stored on ice. Once collected all samples were then dispenced in PBS and diuted by a factor of 1/20 for FACS analysis.<br />
</p><br><br />
<br />
<br><br />
<center><br />
[[Image: glu-repression.jpg|300 px]]<br />
</center><br />
<br />
<br />
<h3>Results</h3><br />
<br />
<br />
<h3>Conclusion</h3><br />
<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T20:55:51Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<br />
<h3>Aim</h3><br />
<p>To test the effect of glucose on repression of the GAL1 promoter, and thus on shut-off of GFP expression from construct GAL1p-[Npeptide-GFP] construct over time.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>The presence of glucose should quickly repress the GAL1 promoter and therefore result in the overall reduction of the GFP intensity present within the cells; measurement of the rate of decay should identify the relative stability of the GFP protein</p><br />
<br />
<h3>Protocol</h3><br />
<p>1. Yeast transformed with the GAL1p-[Npeptide-GFP] construct were innoculated overnight in 5 mls of synthetic defined medium with amino acids; his (0.2 %), met (0.2%), ura (0.2%), trp (0.2 %) and Raffinose (2 %) as the carbon source.<br />
2. Following overnight growth the cells were subcultured in fresh, pre-warmed SD medium (50 mls) containing galactose (a range of concentrations: see Results below) to obtain a predicted OD600 of 0.3 by 10 am the following morning.<br />
3. The following morning, at an OD600 of 0.3, a sample (1 ml) was taken before and after the addition of glucose (2 %). Samples were then taken every 20 minutes thereafter for a period of 167 minutes. All samples were then pelleted (13000 rpm, 5 mins, 4 degreesC), washed once with PBS buffer and stored on ice. Once collected all samples were then dispenced in PBS and diuted by a factor of 1/20 for FACS analysis.<br />
</p><br><br />
<br />
<br><br />
<center><br />
[[Image: glu-repression.jpg]]<br />
</center><br />
<br />
<br />
<h3>Results</h3><br />
<br />
<br />
<h3>Conclusion</h3><br />
<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/File:Glu-repression.jpgFile:Glu-repression.jpg2010-10-25T20:55:15Z<p>I.stansfield: </p>
<hr />
<div></div>I.stansfieldhttp://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415MS2 Coat-Protein Effect on Expression of GFP in pRS4152010-10-25T20:42:01Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<h3>Aim</h3><br />
<p>The characterisation of the effect of MS2 on the expression of GFP by GAL1p-[Npeptide-GFP] will allow more accurate modelling of the system and will allow us to determine with more precision the probability of success of the cross-inhibition of the switch. Expressing MS2 using MET17p - [MS2] will allow us to monitor the effect of MS2 without the complication of the λ-N-peptide produced by GAL1p-[Npeptide-GFP] in turn inhibiting the expression of MS2.</p><br />
<h3>Hypothesis</h3> <br />
<p>The expression of MS2 by MET17p - [MS2]will result in a decrease in the level of expression of GFP by GAL1p-[Npeptide-GFP]. The inhibition will show a linear correlation with the level of expression of MS2.</p><br />
<h3>Protocol</h3><br />
<p>During this experiment double transformants of BY4742 containing GAL1p-[Npeptide-GFP] and MET17p - [MS2] were used. Single transformants of BY4742, containing only GAL1p-[Npeptide-GFP], were used to provide the negative and positive controls for the expression of GFP.</p><br><br />
<p>The double transformants were first cultured overnight in specific conditions in order to establish the desired pre-conditions. The cells were then washed and re-cultured in a different specific set of conditions which would allow the characterisation of the effect of MS2.</p><br><br />
<center><br />
https://static.igem.org/mediawiki/2010/0/04/Conditions_for_FACS_analysis_of_MS2vsGFP.jpg<br />
</center><br />
<p>* 500μM Met was used as this concentration was been used in other experiments to successfully completely switch of the Met17 promoter [1]. <br><br />
<br><br />
The different pre-established conditions allow us to determine whether the history of the sample affects the final result.<br><br />
Final samples were then washed and normalised before being analysed using microscopy, Fluospar Optima readings and FACS analysis.</p><br><br />
<h3>Results</h3><br />
<br />
'''<u>Microscopy</u>'''<br><br />
<p>The microscopy analysis revealed that, in none of the samples, the GFP expression had been completely inhibited. All samples (bar the negative control) showed green fluorescence. The microscope did not allow us to determine if there was any variation however in the levels of GFP in each specific sample. </p><br />
<center><br />
https://static.igem.org/mediawiki/2010/c/c0/MS2vsGFP_fluorescent_cells.jpg<br />
</center><br />
'''<u>Fluospar Optima Readings</u>'''<br><br><br />
The fluorimeter readings correlated the microscopy results by recording fluorescence in all samples except the – control.<br><br />
<center><br />
https://static.igem.org/mediawiki/2010/5/5a/MS2vsGFP_fluorimeter.jpg<br />
</center><br />
<br><br />
<p>The recorded fluorescence values for the respective samples showed that there was indeed some variation in the levels of GFP (Fig 1). In both the ‘MS2 Dom’ and the ‘Race’ sample the GFP level was lower than in the + control indicating that the expression of GFP had indeed been inhibited (a 20% decrease for the ‘Race’ sample and an 11% decrease for the ‘MS2’ sample). The ‘GFP Dom’ sample however showed an approximate 8% increase in GFP fluorescence when compared to the + control. Although this is a bit unexpected is could be due to the fact that the GFP expression was initiated in the 1˚ set of conditions whereas it took place in the 2˚ for the + control. However it appears that no inhibition took place indicating that once GFP is being expressed the amount present of MS2 as expressed by MET17p - [MS2] is not able to significantly inhibit the level of GFP fluorescence.</p><br />
<br><br />
'''<u>FACS analysis</u>'''<br><br />
<p>The first FACS analysis experiment involved running samples from the same initial cultures (see Table 1). The results showed that the presence of the MS2 coat protein was having an effect on the expression of GFP. All three test samples revealed lower levels of GFP when compared to the positive control indicating that MS2 was inhibiting the expression of GFP (see Fig 3). As expected the sample where GFP had been allowed to dominate prior to expression of MS2 (GFPdom sample) showed the highest level of GFP in the test samples and equally the sample where MS2 dominated prior to the expression of GFP (MS2do sample) showed the lowest level of GFP expression.</p><br><br />
<center><br />
https://static.igem.org/mediawiki/2010/a/a5/MS2vsGFP_FACS_1.jpg<br />
</center><br><br />
<p>The second FACS analysis experiment was aimed to determine whether the inhibition of GFP expression was in any way dependent on the levels of MS2. The following cultures were set up containing transformants containing both GAL1p-[Npeptide-GFP] and MET17p - [MS2] with varying amounts of Methionine. The reasoning is that the varying levels of methionine will translate into varying amounts of MS2 being produced as the Met17 is repressed.</p><br><br />
<center><br />
https://static.igem.org/mediawiki/2010/d/d8/MS2vsGFP_FACS_2.jpg<br />
</center><br><br />
<br><br />
<p>The results showed that the inhibition of GFP expression by GAL1p-[Npeptide-GFP] by MS2 previously seen (see Fig.3) is indeed dependent on the concentration of MS2.<br><br />
<br><br />
We can see a linear relationship between GFP levels and MS2 concentrations (see Fig.4). The observed level of GFP is at its lowest with no methionine being present. No methionine present translates as the Met17 promoter being unrepressed meaning that the MS2 expression rate is at its maximum. The levels of GFP gradually increase along with an increasing concentration of methionine (this translates as the Met17 promoter gradually being repressed until MS2 is no longer being expressed).</p><br />
<br />
<h3>References</h3><br />
<br />
<p>[1] Dominik Mumberg, Rolf MulIer and Martin Funk*<br><br />
Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression<br><br />
Nucleic Acids Research, 1994, Vol. 22, No. 25 5767-5768</p><br><br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T20:40:39Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1> Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein </h1><br />
<br />
<h3>Aim</h3><br />
<p>text.</p><br />
<br />
<h3>Hypothesis</h3> <br />
<p>text</p><br />
<br />
<h3>Protocol</h3><br />
<p>tetxt</p><br><br />
<br />
<br><br />
<center><br />
https://static.igem.org/mediawiki/2010/0/04/Conditions_for_FACS_analysis_of_MS2vsGFP.jpg<br />
</center><br />
<br />
<br />
<h3>Results</h3><br />
<br />
<br />
<h3>Conclusion</h3><br />
<br />
<br><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/ResultsTeam:Aberdeen Scotland/Results2010-10-25T20:38:34Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Main Experimental Results</h1><br />
<br />
<h2>1.Promoter characterisation</h2><br />
<br />
<h4>(a) Characterising the CUP1 promoter induction characteristics</h4><br />
<p><br />
Here, we successfully characterised the induction characteristics of the CUP1 promoter using construct CUP1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_the_CUP1_Promoter_Using_N4"><i>Timed Induction of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>Copper Dose Response of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<br><br />
<br />
<h4> b) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br><br />
<br />
<br />
<h2>2.Switch characterisation</h2><br />
<br />
<h4> (a) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>In these experiments, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (b) Measuring the GAL1 promoter dose-responsiveness characteristics </h4><br />
<p>Here, we successfully characterised the dose response characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (c) Quantifying the expression of MS2-CFP from the construct CUP1p-[MS2-CFP]</h4><br />
<p>This experiment identified the failure of the CUP1p-[MS2-CFP] construct to direct expression of the fusion protein at significant level, using a variety of analytical techniques to show that CFP expression was undetectable under a range of conditions</p><br />
<p><a href="https://2010.igem.org/1._Confirmation_using_microscope_and_fluorometer_analysis_that_the_pRS414_construct_was_not_expressing_CFP"><i>Confirmation that CUP1p-[MS2-CFP] did not express CFP</i></a></p><br />
<br><br />
<br />
<h4> (d) Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein.</h4><br />
<p>In these experiments, we used <i>trans</i> expression of the MS2 protein to show that the MS2 stem loops that formed part of the 5’ leader of the GAL1p-[Npeptide-GFP] mRNA were successfully recognised by the MS2 RNA binding protein, to cause translation repression of N-pep-GFP expression, validating our RNA stem loop-based translational control approach. </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expresion on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br />
<br />
<h4> (d) Measuring the decay characteristics of GFP following a switch to non-inducing conditions using GAL1p-[Npeptide-GFP].</h4><br />
<p>In these experiments, a culture grown on galactose, and expressing GFP, was switched to glucose to repress GFP expresion, and the decay profile of GFP measured. The experiment revealed that GFP was extremely stable, and decay was primarily due to dilution through culture growth </p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/GFP_decay"><i>The decay characteristics of GFP following promoter switch-off</i></a></p><br />
<br><br><br />
<br />
<h2>3.Switch troubleshooting</h2><br />
<h4> (a) Cassette replacement experiment – promoter </h4> <br />
<p>Here we used homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a previoulsy tested and functioning CUP1 promoter with 5' untranslated leader sequence <a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>CUP1 Characterisation in CUP1p-GFP</i></a> and determined that the promoter was not the faulty component in CUP1p-[MS2-CFP].</p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a CUP1 promoter plus 5' untranslated leader sequence </i></a></p><br />
<br><br />
<br />
<h4> (b) Cassette replacement experiment – fluorescent protein </h4><br />
<p>Here we replaced the GFP sequence in TEF1p -[GFP] which constitutively expresses GFP with the CFP sequence from CUP1p-[MS2-CFP] and determined that the CFP sequence was expressed properly and therefore functioning correctly. </p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CFP fluorescent protein in CUP1p-[MS2-CFP] with a GFP replacement variant </i></a></p><br />
<br><br><br />
<br />
<br />
<h2>4. Other Biobrick testing </h2><br />
<h4> mOrange experiments </h4><br />
<p>In these experiments, we tested the Biobrick E2050 mOrange from the Registry of Parts and confirmed that within our gene cassette,GAL1p-[Npep-GFP]this Biobrick part did not function as expected. </p><br />
<p><a href="https://2010.igem.org/Homologous_Recombination_of_E2050_into_pRS415_Construct_in_Place_of_GFP_Protein"><i>Homologous Recombination of E2050 into GAL1p-[Npep-GFP] Construct in Place of GFP Protein </i></a></p><br />
<p><br />
<a href="https://2010.igem.org/FACS_Analysis_of_mOrange_recombinant_pRS415"><i>FACS analysis of mOrange expression under Gal1 promoter control in GAL1p-[Npep-mOrange]</i></a></p><br />
<br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Constructs"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to DNA Constructs</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols">Continue to Protocols&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
<br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/GFP_decayTeam:Aberdeen Scotland/GFP decay2010-10-25T20:37:29Z<p>I.stansfield: New page: Aims</p>
<hr />
<div>Aims</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/ResultsTeam:Aberdeen Scotland/Results2010-10-25T20:37:02Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Main Experimental Results</h1><br />
<br />
<h2>1.Promoter characterisation</h2><br />
<br />
<h4>(a) Characterising the CUP1 promoter induction characteristics</h4><br />
<p><br />
Here, we successfully characterised the induction characteristics of the CUP1 promoter using construct CUP1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_the_CUP1_Promoter_Using_N4"><i>Timed Induction of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>Copper Dose Response of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<br><br />
<br />
<h4> b) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br><br />
<br />
<br />
<h2>2.Switch characterisation</h2><br />
<br />
<h4> (a) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>In these experiments, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (b) Measuring the GAL1 promoter dose-responsiveness characteristics </h4><br />
<p>Here, we successfully characterised the dose response characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (c) Quantifying the expression of MS2-CFP from the construct CUP1p-[MS2-CFP]</h4><br />
<p>This experiment identified the failure of the CUP1p-[MS2-CFP] construct to direct expression of the fusion protein at significant level, using a variety of analytical techniques to show that CFP expression was undetectable under a range of conditions</p><br />
<p><a href="https://2010.igem.org/1._Confirmation_using_microscope_and_fluorometer_analysis_that_the_pRS414_construct_was_not_expressing_CFP"><i>Confirmation that CUP1p-[MS2-CFP] did not express CFP</i></a></p><br />
<br><br />
<br />
<h4> (d) Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein.</h4><br />
<p>In these experiments, we used <i>trans</i> expression of the MS2 protein to show that the MS2 stem loops that formed part of the 5’ leader of the GAL1p-[Npeptide-GFP] mRNA were successfully recognised by the MS2 RNA binding protein, to cause translation repression of N-pep-GFP expression, validating our RNA stem loop-based translational control approach. </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expresion on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br><br />
<br />
<h4> (d) Measuring the decay characteristics of GFP following a switch to non-inducing conditions using GAL1p-[Npeptide-GFP].</h4><br />
<p>In these experiments, a culture grown on galactose, and expressing GFP, was switched to glucose to repress GFP expresion, and the decay profile of GFP measured. The experiment revealed that GFP was extremely stable, and decay was primarily due to dilution through culture growth </p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/GFP_decay"><i>The decay characteristics of GFP following promoter switch-off</i></a></p><br />
<br><br><br />
<br />
<h2>3.Switch troubleshooting</h2><br />
<h4> (a) Cassette replacement experiment – promoter </h4> <br />
<p>Here we used homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a previoulsy tested and functioning CUP1 promoter with 5' untranslated leader sequence <a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>CUP1 Characterisation in CUP1p-GFP</i></a> and determined that the promoter was not the faulty component in CUP1p-[MS2-CFP].</p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a CUP1 promoter plus 5' untranslated leader sequence </i></a></p><br />
<br><br />
<br />
<h4> (b) Cassette replacement experiment – fluorescent protein </h4><br />
<p>Here we replaced the GFP sequence in TEF1p -[GFP] which constitutively expresses GFP with the CFP sequence from CUP1p-[MS2-CFP] and determined that the CFP sequence was expressed properly and therefore functioning correctly. </p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CFP fluorescent protein in CUP1p-[MS2-CFP] with a GFP replacement variant </i></a></p><br />
<br><br><br />
<br />
<br />
<h2>4. Other Biobrick testing </h2><br />
<h4> mOrange experiments </h4><br />
<p>In these experiments, we tested the Biobrick E2050 mOrange from the Registry of Parts and confirmed that within our gene cassette,GAL1p-[Npep-GFP]this Biobrick part did not function as expected. </p><br />
<p><a href="https://2010.igem.org/Homologous_Recombination_of_E2050_into_pRS415_Construct_in_Place_of_GFP_Protein"><i>Homologous Recombination of E2050 into GAL1p-[Npep-GFP] Construct in Place of GFP Protein </i></a></p><br />
<p><br />
<a href="https://2010.igem.org/FACS_Analysis_of_mOrange_recombinant_pRS415"><i>FACS analysis of mOrange expression under Gal1 promoter control in GAL1p-[Npep-mOrange]</i></a></p><br />
<br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Constructs"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to DNA Constructs</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols">Continue to Protocols&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
<br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/ResultsTeam:Aberdeen Scotland/Results2010-10-25T20:34:49Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Main Experimental Results</h1><br />
<br />
<h2>1.Promoter characterisation</h2><br />
<br />
<h4>(a) Characterising the CUP1 promoter induction characteristics</h4><br />
<p><br />
Here, we successfully characterised the induction characteristics of the CUP1 promoter using construct CUP1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_the_CUP1_Promoter_Using_N4"><i>Timed Induction of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>Copper Dose Response of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<br><br />
<br />
<h4> b) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br><br />
<br />
<br />
<h2>2.Switch characterisation</h2><br />
<br />
<h4> (a) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>In these experiments, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (b) Measuring the GAL1 promoter dose-responsiveness characteristics </h4><br />
<p>Here, we successfully characterised the dose response characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (c) Quantifying the expression of MS2-CFP from the construct CUP1p-[MS2-CFP]</h4><br />
<p>This experiment identified the failure of the CUP1p-[MS2-CFP] construct to direct expression of the fusion protein at significant level, using a variety of analytical techniques to show that CFP expression was undetectable under a range of conditions</p><br />
<p><a href="https://2010.igem.org/1._Confirmation_using_microscope_and_fluorometer_analysis_that_the_pRS414_construct_was_not_expressing_CFP"><i>Confirmation that CUP1p-[MS2-CFP] did not express CFP</i></a></p><br />
<br><br />
<br />
<h4> (d) Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein.</h4><br />
<p>In these experiments, we used <i>trans</i> expression of the MS2 protein to show that the MS2 stem loops that formed part of the 5’ leader of the GAL1p-[Npeptide-GFP] mRNA were successfully recognised by the MS2 RNA binding protein, to cause translation repression of N-pep-GFP expression, validating our RNA stem loop-based translational control approach. </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expresion on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br><br />
<br />
<h4> (d) Measuring the decay characteristics of GFP following a switch to non-inducing conditions using GAL1p-[Npeptide-GFP].</h4><br />
<p>In these experiments, a culture grown on galactose, and expressing GFP, was switched to glucose to repress GFP expresion, and the decay profile of GFP measured. The experiment revealed that GFP was extremely stable, and decay was primarily due to dilution through culture growth </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expression on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br><br />
<br />
<h2>3.Switch troubleshooting</h2><br />
<h4> (a) Cassette replacement experiment – promoter </h4> <br />
<p>Here we used homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a previoulsy tested and functioning CUP1 promoter with 5' untranslated leader sequence <a href="https://2010.igem.org/Team:Aberdeen_Scotland/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>CUP1 Characterisation in CUP1p-GFP</i></a> and determined that the promoter was not the faulty component in CUP1p-[MS2-CFP].</p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a CUP1 promoter plus 5' untranslated leader sequence </i></a></p><br />
<br><br />
<br />
<h4> (b) Cassette replacement experiment – fluorescent protein </h4><br />
<p>Here we replaced the GFP sequence in TEF1p -[GFP] which constitutively expresses GFP with the CFP sequence from CUP1p-[MS2-CFP] and determined that the CFP sequence was expressed properly and therefore functioning correctly. </p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CFP fluorescent protein in CUP1p-[MS2-CFP] with a GFP replacement variant </i></a></p><br />
<br><br><br />
<br />
<br />
<h2>4. Other Biobrick testing </h2><br />
<h4> mOrange experiments </h4><br />
<p>In these experiments, we tested the Biobrick E2050 mOrange from the Registry of Parts and confirmed that within our gene cassette,GAL1p-[Npep-GFP]this Biobrick part did not function as expected. </p><br />
<p><a href="https://2010.igem.org/Homologous_Recombination_of_E2050_into_pRS415_Construct_in_Place_of_GFP_Protein"><i>Homologous Recombination of E2050 into GAL1p-[Npep-GFP] Construct in Place of GFP Protein </i></a></p><br />
<p><br />
<a href="https://2010.igem.org/FACS_Analysis_of_mOrange_recombinant_pRS415"><i>FACS analysis of mOrange expression under Gal1 promoter control in GAL1p-[Npep-mOrange]</i></a></p><br />
<br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Constructs"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to DNA Constructs</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols">Continue to Protocols&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
<br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T20:28:23Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing between 0.02% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose (see panel B below).<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T20:19:24Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose (see panel B below).<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T20:17:01Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments (panels A and B, immediately below), we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. Panel A shows the raw FACS data, with panel B indicating the quantitation of this data to indicate the inducing effect of different galactose concentrations. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose.<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Team:Aberdeen Scotland/Galactose dose response of Gal1 Promoter in pRS4152010-10-25T20:15:06Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.02% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
(a) Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, for cells grown on medium containing galactose concentrations between 0.05% and 2% w/v </p><br />
<br />
<br><br><br />
<center><br />
[[Image: Gal-facs3.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
(b) In further experiments, we sought to test the ability of even lower concentrations of galactose to induce the Gal1 promoter. Concentrations between 0.02% and 0.07% were tested, revealing that even at 0.02%, galactose was able to induce the GAL1 promoter. The study also revealed that as long as pre-culture in liquid medium was carried out with raffinose (2%) as a carbon source, the prior maintenance of the stock yeast on agar medium containing glucose or raffinose did not affect the ability of the promoter to be subsequently induced by galactose.<br />
<br />
<br><br><br />
<center><br />
[[Image: lowgal-facs.jpg|300 px]]<br />
</center><br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. Testing of low concentrations also showed that the promoter was extremely sensitive, with concentrations as low as 0.02% w/v causing detectable induction of the promoter. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/File:Lowgal-facs.jpgFile:Lowgal-facs.jpg2010-10-25T20:10:20Z<p>I.stansfield: </p>
<hr />
<div></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Project_OverviewTeam:Aberdeen Scotland/Project Overview2010-10-25T11:13:16Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Project Overview</h1><br />
<h3>Introduction</h3><br />
<p> <br />
For this year’s iGEM competition the Aberdeen team has worked on developing a translationally controlled toggle switch embedded in yeast.<a href="#ref1"><sup style="font-size:10px">[1]</sup></a> Genetic toggle switches are a vital component for synthetic biology circuits , enabling functional control of biological functions. The majority of toggle switches used for iGEM are embedded in Escherichia coli and can only be controlled at the transcriptional level <a href="#ref2"><sup style="font-size:10px">[2]</sup></a><sup style="font-size:10px">,</sup><a href="#ref3"><sup style="font-size:10px">[3]</sup></a>. Our main goal was to create and model a novel gene circuit, wherein yeast cells can be switched between mutually exclusive fluorescent proteins under exposure to environmental factors. This switching behaviour would be regulated at the translational level, an innovation over previous systems that only demonstrated transcriptional regulation <a href="#ref4"><sup style="font-size:10px">[4]</sup></a><sup style="font-size:10px">,</sup><a href="#ref5"><sup style="font-size:10px">[5]</sup></a>.The novel genetic toggle switch operated by controlling gene expression at the translational level consisted of two gene expression constructs expressing an RNA-binding protein fused to either Green (GFP) or Cyan (CFP) fluorescent protein in the presence of appropriate inducer. When co-expressed in yeast, these translational fusions would be mutually inhibitory at the translational level, thereby forming a biological, ‘Toggle Switch’ system. <br />
</p><br />
<br><br />
<br />
<h3>The AyeSwitch</h3><br />
<p>The toggle switch is shown by Fig 1 and was named the ‘AyeSwitch’. It is regulated by controlling the two constructs, GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP], via inducible yeast promoters GAL1 or CUP1 in the presence or absence of galactose and Cu2+ ions respectively. <br />
</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/f/ff/Toggle_switch.jpg"><br />
</center><br />
<br><br />
<p><br />
For example, in the presence of galactose only, GAL1 is induced and there is expression of N-peptide-GFP protein. The subsequent addition of Cu2+ then induces the transcription of mRNA coding for MS2 coat binding protein and CFP. In addition to this, the mRNA also codes for a Bbox stem loop sequence that can be bound by N-peptide. </p><br />
<p><br><br />
Ideally, there is initial inhibition of MS2-CFP translation by Npeptide-GFP binding to the Bbox stem loop. Evolution of time corresponds to the ratio of MS2-CFP mRNA to N-peptide-GFP protein increasing allowing some MS2-CFP to be produced until CFP ‘switches ON’ as it gains dominance over GFP.</p><br />
<p><br />
Additionally, N-peptide-GFP protein translation can also be inhibited by MS2-CFP via MS2 protein binding to the MS2 stem loops on the N-peptide-GFP mRNA. This may help the switching ON of CFP and also means GFP would face a similar situation if the inducer was changed from Cu2+ to galactose.</p><br />
<p><br><br />
However, additional variables may come into play affecting the outcomes described above. It is likely that the concentration of each inducer present, the translational rate and binding efficiency of stem loop binding proteins to mRNA stem loop and degradation rate of proteins can also affect the outcome. Reversing the order of inducer present may also affect the outcome. </p><br />
<br><br />
<br />
<h3>Experimental Characterisation of the AyeSwitch</h3><br />
<p><br />
The experimental work addressed these issues by initially characterising the promoters in terms of their dose response and time response using constructs GAL1-[GFP] and CUP1-[GFP]. These experiments were then extended to characterise GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP] which discovered that CUP1p-[MS2-CFP] did not function as expected.</p><br><br />
<p><br />
The experimental work diverged from this point to troubleshoot CUP1p-[MS2-CFP], investigating the translation inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein using construct MET17p - [MS2], Bio-brick construction and testing of Bio-brick E2050 mOrange.</p><br />
<br><br />
<br />
<h3>Troubleshooting CUP1p-[MS2-CFP]</h3><br />
<p><br />
Troubleshooting of CUP1p-[MS2-CFP] was carried out through a series of gene cassette replacement experiments testing the promoter and CFP sequences for functionality. The conclusions to these experiments suggest that the Bbox Stem loop, usually located in the 3’untranslated region but is in the 5’ untranslated region of our construct may be preventing the expression of downstream proteins. It may also be that the fusion of MS2 to CFP results in inappropriate protein folding, inhibiting expression.</p> <br />
<br><br />
<br />
<h3>Verification of Translation Inhibition as a Regulatory Mechanism</h3><br />
<p><br />
It was shown that the translational inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein was possible, confirming that translational regulation is viable. Further work if time permitted would investigate if this inhibition could work in the context of a toggle switch.</p><br />
<br><br />
<br />
<h3>Bio-brick construction and testing </h3><br />
<p><br />
In parallel, Bio-bricks were constructed and submitted to the Registry of parts whilst testing of the Bio-brick E2050 mOrange using fluorimetry and FACS analysis lead to the conclusion that the mOrange sequence did not function within our GAL1p-[Npeptide-GFP] construct that was shown to be able to express GFP appropriately. </p><br />
<br><br><br />
<hr><br />
<br />
<br />
<h1>Attribution and Contributions</h1><br />
<h3>Biological circuit construction and testing </h3><br />
<p><br />
The students within the experimental section of the team were provided (by their host lab) with two yeast strains that had Gal1p-GFP and Cup1p-GFP integrated into the genome (see 'DNA constructs). They then used these constructs to analyse the properties of the CUP1 and GAL1 promoters. With some instructor oversight, the student team themselves then completely designed constructs Gal1p-(Npep-GFP) and Cup1p-(MS2-CFP), which were then synthesised by a synthetic DNA supply company. The students then tested these constructs, and further engineered them during the trouble-shooting phase of the project.<br><br />
All the experimental work described on the wiki, involving characterisation, testing and re-engineering of the bio-bricks, was carried out by the student members of the team. All the construction and sequencing of the four submitted bio-bricks was also carried out by members of the student team.<br />
<br><br><br />
<br />
<h3>Mathematical modelling of the AyeSwitch </h3><br />
<p><br />
The students within the theoretical section of the team carried out all the described modelling. Team activities were overseen by the Instructors, but all model coding and model analysis was performed by the students within the team.<br />
<br />
<br><br><br />
<hr><br />
<h3> References</h3><br><br />
<p><br />
<a name="ref1"></a><br />
<a href="http://www.nature.com/msb/journal/v2/n1/full/msb4100073.html"target="_blank"><b><sup style="font-size:10px">[1]</sup></b></a> Ernesto Andrianantoandro et al. Synthetic biology: new engineering rules for an emerging discipline Molecular Systems Biology 2:2006.0028</p><br><br />
<p><br />
<a name="ref2"></a><br />
<a href="http://www.nature.com/nature/journal/v403/n6767/abs/403339a0.html"target="_blank"><b><sup style="font-size:10px">[2]</sup></b></a> Timothy S. Gardner et al. Construction of a genetic toggle switch in Escherichia coli Nature 403, 339-342 (20 January 2000)</p><br><br />
<p><br />
<a name="ref3"></a><br />
<a href="http://www.cell.com/retrieve/pii/S0092867403003465"target="_blank"><b><sup style="font-size:10px">[3]</sup></b></a> Mariette R. Atkinson et al. Development of Genetic Circuitry Exhibiting Toggle Switch or Oscillatory Behavior in Escherichia coli Cell, Volume 113, Issue 5, 597-607, 30 May 2003 </p><br><br />
<p><br />
<a name="ref4"></a><br />
<a href="http://www.nature.com/emboj/journal/v17/n14/abs/7591108a.html"target="_blank"><b><sup style="font-size:10px">[4]</sup></b></a> Adam Platt and Richard J Reece The yeast galactose genetic switch is mediated by the formation of a Gal4p–Gal80p–Gal3p complex The EMBO Journal (1998) 17, 4086 - 4091 </p><br><br />
<p><br />
<a name="ref5"></a><br />
<a href="http://www.pnas.org/content/88/19/8597.abstract"target="_blank"><b><sup style="font-size:10px">[5]</sup></b></a> D W Griggs and M Johnston Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression PNAS October 1, 1991 vol. 88 no. 19 8597-8601</i></p><br />
<br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Home Page</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Team">Continue to iGEM at Aberdeen&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:26:12Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T23:25:51Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
FACS data showing the changes to the GFP expression (peak to right) and non GFP expressing cells (peak to left) over time as a result of galactose being added.<br />
<br />
There are two significant peaks. The peak to the left of the graph represents the number of cells which did not express GFP and the peak to the right the number of the cells which did express GFP. <br />
The highest peak to the left is produced by the cells before adding galactose and the peak to the right is not present thus there is no GFP expression by the cells at time zero of the experiment, hence no natural GFP expression by the cells.<br />
As time increases there is an increased number of cells which are expressing GFP in the presence of galactose inducer, shown by the gradual increase of the peak to the right over time. The visible peak starts appearing 60 mins after adding galactose (the light blue line). </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs.jpg|300 px]]<br />
<br />
<br><br><br />
[[Image: Gal-facs2.jpg|300 px]]<br />
<br />
<br><br><br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases over time after galactose has been added. The graph does not reach a plateau opver the time of the experiment. This may suggest that the cells have not expressed to their maximum capacity. Therefore to conclude, further experiments may be repeated with an increased galactose concentration or an increased period of time over which the experiment was carried out.<br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP increased to 68% after 167 minutes from the time that 0.1 % galactose was added to the culture medium. This therefore clearly showing that galactose has successfully induced the expression of the GFP from the GAL1-(Npep-GFP) construct. Expression induction was almost linear over this time, and after 167 minutes, the expression induction had still not reached a plateau. <br />
</p><br />
<b>[[https://2010.igem.org/Team:Aberdeen_Scotland/Results Return to Results Main page]]</b><br />
<br></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/ResultsTeam:Aberdeen Scotland/Results2010-10-24T23:24:57Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Main Experimental Results</h1><br />
<br />
<h2>1.Promoter characterisation</h2><br />
<br />
<h4>(a) Characterising the CUP1 promoter induction characteristics</h4><br />
<p><br />
Here, we successfully characterised the induction characteristics of the CUP1 promoter using construct CUP1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Timed_Induction_of_the_CUP1_Promoter_Using_N4"><i>Timed Induction of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<p><a href="https://2010.igem.org/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>Copper Dose Response of the CUP1 Promoter Using CUP1p-GFP</i></a></p><br />
<br><br />
<br />
<h4> b) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1-[GFP]</p><br />
<p><a href="https://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<p><a href="https://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br><br />
<br />
<br />
<h2>2.Switch characterisation</h2><br />
<br />
<h4> (a) Characterising the GAL1 promoter induction characteristics </h4><br />
<p>Here, we successfully characterised the induction characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415"><i>Timed Induction of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (b) Characterising the GAL1 promoter dose-responsiveness characteristics </h4><br />
<p>Here, we successfully characterised the dose response characteristics of the GAL1 promoter using construct GAL1p-[Npeptide-GFP]</p><br />
<p><a href="https://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415"><i>Galactose Dose Response of Gal1 Promoter using GAL1p-[Npep-GFP]</i></a></p><br />
<br><br />
<br />
<h4> (c) Characterising the expression of MS2-CFP from the construct CUP1p-[MS2-CFP]</h4><br />
<p>Here we identified the failure of the CUP1p-[MS2-CFP] construct to direct expression of the fusion protein at significant level, using a variety of analytical techniques to show that CFP expression was undetectable under a range of conditions</p><br />
<p><a href="https://2010.igem.org/1._Confirmation_using_microscope_and_fluorometer_analysis_that_the_pRS414_construct_was_not_expressing_CFP"><i>Confirmation that CUP1p-[MS2-CFP] did not express CFP</i></a></p><br />
<br><br />
<br />
<h4> (d) Characterising the translational repression of GAL1p-[Npeptide-GFP] by trans expression of the MS2 protein.</h4><br />
<p>Here, we used <i>trans</i> expression of the MS2 protein to show that the MS2 stem loops that formed part of the 5’ leader of the GAL1p-[Npeptide-GFP] mRNA were successfully recognised by the MS2 RNA binding protein, to cause translation repression of N-pep-GFP expression, validating our RNA stem loop-based translational control approach. </p><br />
<p><a href="https://2010.igem.org/MS2_Coat-Protein_Effect_on_Expression_of_GFP_in_pRS415"><i>The effect of MS2 coat protein expresion on GAL1p-[Npep-GFP] expression</i></a></p><br />
<br><br><br />
<br />
<h2>3.Switch troubleshooting</h2><br />
<h4> (a) Cassette replacement experiment – promoter </h4> <br />
<p>Here we used homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a previoulsy tested and functioning CUP1 promoter with 5' untranslated leader sequence <a href="https://2010.igem.org/Copper_Dose_Response_of_the_CUP1_Promoter_Using_N4"><i>CUP1 Characterisation in CUP1p-GFP</i></a> and determined that the promoter was not the faulty component in CUP1p-[MS2-CFP].</p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CUP1 promoter in CUP1p-[MS2-CFP] with a CUP1 promoter plus 5' untranslated leader sequence </i></a></p><br />
<br><br />
<br />
<h4> (b) Cassette replacement experiment – fluorescent protein </h4><br />
<p>Here we replaced the GFP sequence in TEF1p -[GFP] which constitutively expresses GFP with the CFP sequence from CUP1p-[MS2-CFP] and determined that the CFP sequence was expressed properly and therefore functioning correctly. </p><br />
<p><a href="https://2010.igem.org/Experimental_Layout"><i>Using homologous recombination to replace the CFP fluorescent protein in CUP1p-[MS2-CFP] with a GFP replacement variant </i></a></p><br />
<br><br><br />
<br />
<br />
<h2>4. Other Biobrick testing </h2><br />
<h4> mOrange experiments </h4><br />
<p>In these experiments, we tested the Biobrick E2050 mOrange from the Registry of Parts and confirmed that within our gene cassette,GAL1p-[Npep-GFP]this Biobrick part did not function as expected. </p><br />
<p><a href="https://2010.igem.org/Homologous_Recombination_of_E2050_into_pRS415_Construct_in_Place_of_GFP_Protein"><i>Homologous Recombination of E2050 into GAL1p-[Npep-GFP] Construct in Place of GFP Protein </i></a></p><br />
<p><br />
<a href="https://2010.igem.org/FACS_Analysis_of_mOrange_recombinant_pRS415"><i>FACS analysis of mOrange expression under Gal1 promoter control in GAL1p-[Npep-mOrange]</i></a></p><br />
<br />
<br><br><br />
<hr><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Constructs"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to DNA Constructs</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols">Continue to Protocols&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
</html><br />
<br />
{{:Team:Aberdeen_Scotland/Footer}}</div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:21:24Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of dose responsiveness of the GAL1 promoter to galactose using construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:19:42Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and an emission filter of 510 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:19:17Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and a emission filter of 510 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:18:54Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 488 nm, and a emission filter of 510 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. The observed GFP expression response suggests that the GAL1 promoter behaves as an analogue switch across only a very narrow range of inducer concentrations. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:15:14Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p><br />
Previous dose response experiments using the fluorometer revealed that full GAL1 promoter induction was achieved at concentrations above 0.5% (data not shown). We wanted to examine the dose responsive behaviour of the GAL1 promoter across a full range of concentrations. Therefore the dose response experiments were repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening this cell culture was sub-cultured into a flask containing pre-warmed SD medium (50 mls) with 2% raffinose, and one of a range of concentrations of galactose between 0.05% and 2% of galactose, to achieve an optical density at 600nm of 0.6 by 9.00 am the following morning. <br><br />
<br />
<br><br />
3. Samples were washed into PBS, and diluted 1/20 in preparation for FACS analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
Flow cytometry was used to quantify GFP fluorescence, with an excitation wavelength of 480 nm, and a emission filter of 480 nm, </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitivity to the inducing agent, with concentrations as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:03:20Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
FACS data </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitiveity to the inducing agent, with concentraitons as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.1% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Galactose_dose_response_of_Gal1_Promoter_in_pRS415Galactose dose response of Gal1 Promoter in pRS4152010-10-24T23:02:56Z<p>I.stansfield: New page: <h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1> <h3>Aim</h3> <p>The previous dose response experiment using the fluorometer (will link the ex...</p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The previous dose response experiment using the fluorometer (will link the exp) did not show a steady increase of GFP expression with increasing galactose concentrations. Therefore the experiment was repeated using lower concentrations of this inducing agent. We have therefore tested media containing: 0.5%, 0.1%, 0.2%, 0.3%, 0.5%, 1% and 2% of galactose. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
FACS data </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs3.jpg|300 px]]<br />
<br />
<br><br><br />
<br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases in response to the percentage of galactose in the growth medium. The GAL1 promoter in our construct showed a high degree of sensitiveity to the inducing agent, with concentraitons as low as 0.01% having significant inducing potential. <br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP was exquisitely sensitive to the presence of galactose, with the dose response saturating above 0.5% galactose. This therefore clearly shows that the GAL1 promoter is highly sensitive, but that as a synthetic biology part, it may not exhibit ideal linear responses to inducing agent for some applications. <br />
The observed GFP induction curve suggests that the promoter behaves as an analogue switch only over a very narrow range of galactose concentrations.<br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/File:Gal-facs3.jpgFile:Gal-facs3.jpg2010-10-24T22:55:21Z<p>I.stansfield: </p>
<hr />
<div></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:33:52Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br />
FACS data showing the changes to the GFP expression (peak to right) and non GFP expressing cells (peak to left) over time as a result of galactose being added.<br />
<br />
There are two significant peaks. The peak to the left of the graph represents the number of cells which did not express GFP and the peak to the right the number of the cells which did express GFP. <br />
The highest peak to the left is produced by the cells before adding galactose and the peak to the right is not present thus there is no GFP expression by the cells at time zero of the experiment, hence no natural GFP expression by the cells.<br />
As time increases there is an increased number of cells which are expressing GFP in the presence of galactose inducer, shown by the gradual increase of the peak to the right over time. The visible peak starts appearing 60 mins after adding galactose (the light blue line). </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs.jpg|300 px]]<br />
<br />
<br><br><br />
[[Image: Gal-facs2.jpg|300 px]]<br />
<br />
<br><br><br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases over time after galactose has been added. The graph does not reach a plateau opver the time of the experiment. This may suggest that the cells have not expressed to their maximum capacity. Therefore to conclude, further experiments may be repeated with an increased galactose concentration or an increased period of time over which the experiment was carried out.<br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP increased to 68% after 167 minutes from the time that 0.1 % galactose was added to the culture medium. This therefore clearly showing that galactose has successfully induced the expression of the GFP from the GAL1-(Npep-GFP) construct. Expression induction was almost linear over this time, and after 167 minutes, the expression induction had still not reached a plateau. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:33:20Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeast transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
FACS data showing the changes to the GFP expression (peak to right) and non GFP expressing cells (peak to left) over time as a result of galactose being added.<br />
<br />
There are two significant peaks. The peak to the left of the graph represents the number of cells which did not express GFP and the peak to the right the number of the cells which did express GFP. <br />
The highest peak to the left is produced by the cells before adding galactose and the peak to the right is not present thus there is no GFP expression by the cells at time zero of the experiment, hence no natural GFP expression by the cells.<br />
As time increases there is an increased number of cells which are expressing GFP in the presence of galactose inducer, shown by the gradual increase of the peak to the right over time. The visible peak starts appearing 60 mins after adding galactose (the light blue line). </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs.jpg|300 px]]<br />
<br />
<br><br><br />
[[Image: Gal-facs2.jpg|300 px]]<br />
<br />
<br><br><br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases over time after galactose has been added. The graph does not reach a plateau opver the time of the experiment. This may suggest that the cells have not expressed to their maximum capacity. Therefore to conclude, further experiments may be repeated with an increased galactose concentration or an increased period of time over which the experiment was carried out.<br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP increased to 68% after 167 minutes from the time that 0.1 % galactose was added to the culture medium. This therefore clearly showing that galactose has successfully induced the expression of the GFP from the GAL1-(Npep-GFP) construct. Expression induction was almost linear over this time, and after 167 minutes, the expression induction had still not reached a plateau. <br />
</p><br />
<br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:32:47Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeasts transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
FACS data showing the changes to the GFP expression (peak to right) and non GFP expressing cells (peak to left) over time as a result of galactose being added.<br />
<br />
There are two significant peaks. The peak to the left of the graph represents the number of cells which did not express GFP and the peak to the right the number of the cells which did express GFP. <br />
The highest peak to the left is produced by the cells before adding galactose and the peak to the right is not present thus there is no GFP expression by the cells at time zero of the experiment, hence no natural GFP expression by the cells.<br />
As time increases there is an increased number of cells which are expressing GFP in the presence of galactose inducer, shown by the gradual increase of the peak to the right over time. The visible peak starts appearing 60 mins after adding galactose (the light blue line). </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs.jpg|300 px]]<br />
<br />
<br><br><br />
[[Image: Gal-facs2.jpg|300 px]]<br />
<br />
<br><br><br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases over time after galactose has been added. The graph does not reach a plateau opver the time of the experiment. This may suggest that the cells have not expressed to their maximum capacity. Therefore to conclude, further experiments may be repeated with an increased galactose concentration or an increased period of time over which the experiment was carried out.<br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP increased to 68% after 167 minutes from the time that 0.1 % galactose was added to the culture medium. This therefore clearly showing that galactose has successfully induced the expression of the GFP from the GAL1-(Npep-GFP) construct. Expression induction was almost linear over this time, and after 167 minutes, the expression induction had still not reached a plateau. <br />
</p><br />
<br />
</html><br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:23:08Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment was to test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. Construct Gal1p-(Npep-GFP) was used in the experiments described here <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeasts transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
FACS data showing the changes to the GFP expression (peak to right) and non GFP expressing cells (peak to left) over time as a result of galactose being added.<br />
<br />
There are two significant peaks. The peak to the left of the graph represents the number of cells which did not express GFP and the peak to the right the number of the cells which did express GFP. <br />
The highest peak to the left is produced by the cells before adding galactose and the peak to the right is not present thus there is no GFP expression by the cells at time zero of the experiment, hence no natural GFP expression by the cells.<br />
As time increases there is an increased number of cells which are expressing GFP in the presence of galactose inducer, shown by the gradual increase of the peak to the right over time. The visible peak starts appearing 60 mins after adding galactose (the light blue line). </p><br />
<br />
<br><br><br />
<br />
[[Image: Gal-facs.jpg|300 px]]<br />
<br />
<br><br><br />
[[Image: Gal-facs2.jpg|300 px]]<br />
<br />
<br><br><br />
The graph above summarises the FACS data, and shows that the intensity of GFP expressing cells increases over time after galactose has been added. At 100 minutes the increase appears to be levelling off however there also appears to be another increase in expression at 160 minutes. This may suggest that the cells have not expressed to their maximum capacity or that experimental error has occurred. Therefore to conclude further the experiment may be repeated with an increased galactose concentration or an increased period of time in which the experiment was carried out.<br />
<br><br><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
The experiment clearly showed that the percentage of cells expressing GFP increased to 68% after 167 minutes from the time that 0.1 % galactose was added. Therefore clearly showing that galactose has successfully induced the expression of the GFP from the pRS415 construct at the translational level. Expression rate does appear to decrease over time however further experiments would be required to accurately conclude the time required to reach the maximum expression.<br />
</p><br />
<br />
</html><br />
<br></div>I.stansfieldhttp://2010.igem.org/File:Gal-facs2.jpgFile:Gal-facs2.jpg2010-10-24T22:21:24Z<p>I.stansfield: </p>
<hr />
<div></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:12:19Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment <br />
To test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeasts transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
<p><br />
Text<br />
</p><br />
<br />
<center><br />
https://static.igem.org/mediawiki/2010/0/04/Gal-facs.jpg<br />
</center><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
Text<br />
</p><br />
<br />
</html><br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:11:39Z<p>I.stansfield: </p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment <br />
To test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeasts transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
<p><br />
Text<br />
</p><br />
<br />
<center><br />
https://static.igem.org/mediawiki/2010/0/04/Gal-FACS.jpg<br />
</center><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
Text<br />
</p><br />
<br />
</html><br />
<br></div>I.stansfieldhttp://2010.igem.org/Timed_Induction_of_Gal1_Promoter_in_pRS415Timed Induction of Gal1 Promoter in pRS4152010-10-24T22:09:13Z<p>I.stansfield: New page: <h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1> <h3>Aim</h3> <p>The aim of this experiment To test the response of the GAL1 promoter in the ...</p>
<hr />
<div><h1>Measurement of induction of the GAL1 promoter over time in construct GAL1p-(Npep-GFP)</h1><br />
<h3>Aim</h3><br />
<p>The aim of this experiment <br />
To test the response of the GAL1 promoter in the presence of galactose over time, by measuring the expression of GFP, the downstream gene. <br />
</p><br />
<br />
<h3>Protocol</h3><br />
<p><br />
1. Yeasts transformed with a plasmid carrying the GAL1p-(Npep-GFP) construct was inoculated overnight into 5 ml of synthetic defined (SD) medium with amino acids: his (0.2 %), met (0.2 %), ura (0.2 %), trp (0.2 %) and Raffinose (2 %) as the carbon source. <br><br />
<br />
2. The following evening 861 µl of this cell culture were sub-cultured into a flask containing pre-warmed SD medium (50 mls) to achieve an optical density at 600nm of 0.3 by 10am the following morning. <br><br />
<br />
<br><br />
3. At OD 600 of 0.30, a 1 ml sample was taken to represent the t=0 min sample, and then galactose addded to a final concentration of 0.1 % w/v to begin the promoter induction process. Samples were then taken every 20 minutes thereafter for a period of 170 minutes. All samples were pelleted (13000 rpm, 5min, 4 degrees C), washed once with PBS buffer and stored on ice. Once collected all samples were then dispensed in PBS and diluted by a factor of 1/20 for flow cytometry analysis.<br />
<br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
<p><br />
Text<br />
</p><br />
<br />
<h3>Conclusion</h3><br />
<p><br />
Text<br />
</p><br />
<br />
</html><br />
<br></div>I.stansfieldhttp://2010.igem.org/File:Gal-facs.jpgFile:Gal-facs.jpg2010-10-24T22:08:41Z<p>I.stansfield: </p>
<hr />
<div></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Project_OverviewTeam:Aberdeen Scotland/Project Overview2010-10-24T21:22:16Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Project Overview</h1><br />
<br><br />
<h3>Introduction</h3><br />
<p> <br />
For this year’s iGEM competition the Aberdeen team has worked on developing a translationally controlled toggle switch embedded in yeast.<a href="#ref1"><sup style="font-size:10px">[1]</sup></a> Genetic toggle switches are a vital component for synthetic biology circuits , enabling functional control of biological functions. The majority of toggle switches used for iGEM are embedded in Escherichia coli and can only be controlled at the transcriptional level <a href="#ref2"><sup style="font-size:10px">[2]</sup></a><sup style="font-size:10px">,</sup><a href="#ref3"><sup style="font-size:10px">[3]</sup></a>. Our main goal was to create and model a novel gene circuit, wherein yeast cells can be switched between mutually exclusive fluorescent proteins under exposure to environmental factors. This switching behaviour would be regulated at the translational level, an innovation over previous systems that only demonstrated transcriptional regulation <a href="#ref4"><sup style="font-size:10px">[4]</sup></a><sup style="font-size:10px">,</sup><a href="#ref5"><sup style="font-size:10px">[5]</sup></a>.The novel genetic toggle switch operated by controlling gene expression at the translational level consisted of two gene expression constructs expressing an RNA-binding protein fused to either Green (GFP) or Cyan (CFP) fluorescent protein in the presence of appropriate inducer. When co-expressed in yeast, these translational fusions would be mutually inhibitory at the translational level, thereby forming a biological, ‘Toggle Switch’ system. <br />
</p><br />
<br><br />
<br />
<h3>The AyeSwitch</h3><br />
<p>The toggle switch is shown by Fig 1 and was named the ‘AyeSwitch’. It is regulated by controlling the two constructs, GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP], via inducible yeast promoters GAL1 or CUP1 in the presence or absence of galactose and Cu2+ ions respectively. <br />
</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/f/ff/Toggle_switch.jpg"><br />
</center><br />
<br><br />
<p><br />
For example, in the presence of galactose only, GAL1 is induced and there is expression of N-peptide-GFP protein. The subsequent addition of Cu2+ then induces the transcription of mRNA coding for MS2 coat binding protein and CFP. In addition to this, the mRNA also codes for a Bbox stem loop sequence that can be bound by N-peptide. </p><br />
<p><br><br />
Ideally, there is initial inhibition of MS2-CFP translation by Npeptide-GFP binding to the Bbox stem loop. Evolution of time corresponds to the ratio of MS2-CFP mRNA to N-peptide-GFP protein increasing allowing some MS2-CFP to be produced until CFP ‘switches ON’ as it gains dominance over GFP.</p><br />
<p><br />
Additionally, N-peptide-GFP protein translation can also be inhibited by MS2-CFP via MS2 protein binding to the MS2 stem loops on the N-peptide-GFP mRNA. This may help the switching ON of CFP and also means GFP would face a similar situation if the inducer was changed from Cu2+ to galactose.</p><br />
<p><br><br />
However, additional variables may come into play affecting the outcomes described above. It is likely that the concentration of each inducer present, the translational rate and binding efficiency of stem loop binding proteins to mRNA stem loop and degradation rate of proteins can also affect the outcome. Reversing the order of inducer present may also affect the outcome. </p><br />
<br><br />
<br />
<h3>Experimental Characterisation of the AyeSwitch</h3><br />
<p><br />
The experimental work addressed these issues by initially characterising the promoters in terms of their dose response and time response using constructs GAL1-[GFP] and CUP1-[GFP]. These experiments were then extended to characterise GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP] which discovered that CUP1p-[MS2-CFP] did not function as expected.</p><br><br />
<p><br />
The experimental work diverged from this point to troubleshoot CUP1p-[MS2-CFP], investigating the translation inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein using construct MET17p - [MS2], Bio-brick construction and testing of Bio-brick E2050 mOrange.</p><br />
<br><br />
<br />
<h3>Troubleshooting CUP1p-[MS2-CFP]</h3><br />
<p><br />
Troubleshooting of CUP1p-[MS2-CFP] was carried out through a series of gene cassette replacement experiments testing the promoter and CFP sequences for functionality. The conclusions to these experiments suggest that the Bbox Stem loop, usually located in the 3’untranslated region but is in the 5’ untranslated region of our construct may be preventing the expression of downstream proteins. It may also be that the fusion of MS2 to CFP results in inappropriate protein folding, inhibiting expression.</p> <br />
<br><br />
<br />
<h3>Verification of Translation Inhibition as a Regulatory Mechanism</h3><br />
<p><br />
It was shown that the translational inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein was possible, confirming that translational regulation is viable. Further work if time permitted would investigate if this inhibition could work in the context of a toggle switch.</p><br />
<br><br />
<br />
<h3>Bio-brick construction and testing </h3><br />
<p><br />
In parallel, Bio-bricks were constructed and submitted to the Registry of parts whilst testing of the Bio-brick E2050 mOrange using fluorimetry and FACS analysis lead to the conclusion that the mOrange sequence did not function within our GAL1p-[Npeptide-GFP] construct that was shown to be able to express GFP appropriately. </p><br />
<br><br><br />
<hr><br />
<br />
<br />
<h1>Attribution and Contributions</h1><br />
<h3>Biological circuit construction and testing </h3><br />
<p><br />
The students within the experimental section of the team were provided (by their host lab) with two yeast strains that had Gal1p-GFP and Cup1p-GFP integrated into the genome (see 'DNA constructs). They then used these constructs to analyse the properties of the CUP1 and GAL1 promoters. With some instructor oversight, the student team themselves then completely designed constructs Gal1p-(Npep-GFP) and Cup1p-(MS2-CFP), which were then synthesised by a synthetic DNA supply company. The students then tested these constructs, and further engineered them during the trouble-shooting phase of the project.<br><br />
All the experimental work on the wiki, involving testing and re-engineering of the bio-bricks, was carried out by the student members of the team. All the construction and sequencing of the four submitted bio-bricks was also carried out by members of the student team.<br />
<br><br><br />
<br />
<h3>Mathematical modelling of the AyeSwitch </h3><br />
<p><br />
The students within the theoretical section of the team carried out all the described modelling. Team activities were overseen by the Instructors, but all model coding and model analysis was performed by the students within the team.<br />
<br />
<br><br><br />
<br />
<br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Home</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Team">Continue to iGEM at Aberdeen&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
<hr><br />
<br><br><br />
<h3> References</h3><br><br />
<p><br />
<a name="ref1"></a><br />
<a href="http://www.nature.com/msb/journal/v2/n1/full/msb4100073.html"target="_blank"><b><sup style="font-size:10px">[1]</sup></b></a> Ernesto Andrianantoandro et al. Synthetic biology: new engineering rules for an emerging discipline Molecular Systems Biology 2:2006.0028</p><br><br />
<p><br />
<a name="ref2"></a><br />
<a href="http://www.nature.com/nature/journal/v403/n6767/abs/403339a0.html"target="_blank"><b><sup style="font-size:10px">[2]</sup></b></a> Timothy S. Gardner et al. Construction of a genetic toggle switch in Escherichia coli Nature 403, 339-342 (20 January 2000)</p><br><br />
<p><br />
<a name="ref3"></a><br />
<a href="http://www.cell.com/retrieve/pii/S0092867403003465"target="_blank"><b><sup style="font-size:10px">[3]</sup></b></a> Mariette R. Atkinson et al. Development of Genetic Circuitry Exhibiting Toggle Switch or Oscillatory Behavior in Escherichia coli Cell, Volume 113, Issue 5, 597-607, 30 May 2003 </p><br><br />
<p><br />
<a name="ref4"></a><br />
<a href="http://www.nature.com/emboj/journal/v17/n14/abs/7591108a.html"target="_blank"><b><sup style="font-size:10px">[4]</sup></b></a> Adam Platt and Richard J Reece The yeast galactose genetic switch is mediated by the formation of a Gal4p–Gal80p–Gal3p complex The EMBO Journal (1998) 17, 4086 - 4091 </p><br><br />
<p><br />
<a name="ref5"></a><br />
<a href="http://www.pnas.org/content/88/19/8597.abstract"target="_blank"><b><sup style="font-size:10px">[5]</sup></b></a> D W Griggs and M Johnston Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression PNAS October 1, 1991 vol. 88 no. 19 8597-8601</i></p><br />
<br />
</html></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Project_OverviewTeam:Aberdeen Scotland/Project Overview2010-10-24T21:21:01Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Project Overview</h1><br />
<br><br />
<h3>Introduction</h3><br />
<p> <br />
For this year’s iGEM competition the Aberdeen team has worked on developing a translationally controlled toggle switch embedded in yeast.<a href="#ref1"><sup style="font-size:10px">[1]</sup></a> Genetic toggle switches are a vital component for synthetic biology circuits , enabling functional control of biological functions. The majority of toggle switches used for iGEM are embedded in Escherichia coli and can only be controlled at the transcriptional level <a href="#ref2"><sup style="font-size:10px">[2]</sup></a><sup style="font-size:10px">,</sup><a href="#ref3"><sup style="font-size:10px">[3]</sup></a>. Our main goal was to create and model a novel gene circuit, wherein yeast cells can be switched between mutually exclusive fluorescent proteins under exposure to environmental factors. This switching behaviour would be regulated at the translational level, an innovation over previous systems that only demonstrated transcriptional regulation <a href="#ref4"><sup style="font-size:10px">[4]</sup></a><sup style="font-size:10px">,</sup><a href="#ref5"><sup style="font-size:10px">[5]</sup></a>.The novel genetic toggle switch operated by controlling gene expression at the translational level consisted of two gene expression constructs expressing an RNA-binding protein fused to either Green (GFP) or Cyan (CFP) fluorescent protein in the presence of appropriate inducer. When co-expressed in yeast, these translational fusions would be mutually inhibitory at the translational level, thereby forming a biological, ‘Toggle Switch’ system. <br />
</p><br />
<br><br />
<br />
<h3>The AyeSwitch</h3><br />
<p>The toggle switch is shown by Fig 1 and was named the ‘AyeSwitch’. It is regulated by controlling the two constructs, GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP], via inducible yeast promoters GAL1 or CUP1 in the presence or absence of galactose and Cu2+ ions respectively. <br />
</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/f/ff/Toggle_switch.jpg"><br />
</center><br />
<br><br />
<p><br />
For example, in the presence of galactose only, GAL1 is induced and there is expression of N-peptide-GFP protein. The subsequent addition of Cu2+ then induces the transcription of mRNA coding for MS2 coat binding protein and CFP. In addition to this, the mRNA also codes for a Bbox stem loop sequence that can be bound by N-peptide. </p><br />
<p><br><br />
Ideally, there is initial inhibition of MS2-CFP translation by Npeptide-GFP binding to the Bbox stem loop. Evolution of time corresponds to the ratio of MS2-CFP mRNA to N-peptide-GFP protein increasing allowing some MS2-CFP to be produced until CFP ‘switches ON’ as it gains dominance over GFP.</p><br />
<p><br />
Additionally, N-peptide-GFP protein translation can also be inhibited by MS2-CFP via MS2 protein binding to the MS2 stem loops on the N-peptide-GFP mRNA. This may help the switching ON of CFP and also means GFP would face a similar situation if the inducer was changed from Cu2+ to galactose.</p><br />
<p><br><br />
However, additional variables may come into play affecting the outcomes described above. It is likely that the concentration of each inducer present, the translational rate and binding efficiency of stem loop binding proteins to mRNA stem loop and degradation rate of proteins can also affect the outcome. Reversing the order of inducer present may also affect the outcome. </p><br />
<br><br />
<br />
<h3>Experimental Characterisation of the AyeSwitch</h3><br />
<p><br />
The experimental work addressed these issues by initially characterising the promoters in terms of their dose response and time response using constructs GAL1-[GFP] and CUP1-[GFP]. These experiments were then extended to characterise GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP] which discovered that CUP1p-[MS2-CFP] did not function as expected.</p><br><br />
<p><br />
The experimental work diverged from this point to troubleshoot CUP1p-[MS2-CFP], investigating the translation inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein using construct MET17p - [MS2], Bio-brick construction and testing of Bio-brick E2050 mOrange.</p><br />
<br><br />
<br />
<h3>Troubleshooting CUP1p-[MS2-CFP]</h3><br />
<p><br />
Troubleshooting of CUP1p-[MS2-CFP] was carried out through a series of gene cassette replacement experiments testing the promoter and CFP sequences for functionality. The conclusions to these experiments suggest that the Bbox Stem loop, usually located in the 3’untranslated region but is in the 5’ untranslated region of our construct may be preventing the expression of downstream proteins. It may also be that the fusion of MS2 to CFP results in inappropriate protein folding, inhibiting expression.</p> <br />
<br><br />
<br />
<h3>Verification of Translation Inhibition as a Regulatory Mechanism</h3><br />
<p><br />
It was shown that the translational inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein was possible, confirming that translational regulation is viable. Further work if time permitted would investigate if this inhibition could work in the context of a toggle switch.</p><br />
<br><br />
<br />
<h3>Bio-brick construction and testing </h3><br />
<p><br />
In parallel, Bio-bricks were constructed and submitted to the Registry of parts whilst testing of the Bio-brick E2050 mOrange using fluorimetry and FACS analysis lead to the conclusion that the mOrange sequence did not function within our GAL1p-[Npeptide-GFP] construct that was shown to be able to express GFP appropriately. </p><br />
<br><br><br />
<hr><br />
<h1>Attribution and Contributions</h1><br />
<h3>Biological circuit construction and testing </h3><br />
<p><br />
The students within the experimental section of the team were provided (by their host lab) with two yeast strains that had Gal1p-GFP and Cup1p-GFP integrated into the genome (see 'DNA constructs). They then used these constructs to analyse the properties of the CUP1 and GAL1 promoters. With some instructor oversight, the student team themselves then completely designed constructs Gal1p-(Npep-GFP) and Cup1p-(MS2-CFP), which were then synthesised by a synthetic DNA supply company. The students then tested these constructs, and further engineered them during the trouble-shooting phase of the project.<br><br />
All the experimental work on the wiki, involving testing and re-engineering of the bio-bricks, was carried out by the student members of the team. All the construction of the four submitted bio-bricks was also carried out by members of the student team.<br />
<br><br><br />
<br />
<h3>Mathematical modelling of the AyeSwitch </h3><br />
<p><br />
The students within the theoretical section of the team carried out all the described modelling. Team activities were overseen by the Instructors, but all model coding and model analysis was performed by the students within the team.<br />
<br />
<br><br><br />
<br />
<br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Home</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Team">Continue to iGEM at Aberdeen&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
<hr><br />
<br><br><br />
<h3> References</h3><br><br />
<p><br />
<a name="ref1"></a><br />
<a href="http://www.nature.com/msb/journal/v2/n1/full/msb4100073.html"target="_blank"><b><sup style="font-size:10px">[1]</sup></b></a> Ernesto Andrianantoandro et al. Synthetic biology: new engineering rules for an emerging discipline Molecular Systems Biology 2:2006.0028</p><br><br />
<p><br />
<a name="ref2"></a><br />
<a href="http://www.nature.com/nature/journal/v403/n6767/abs/403339a0.html"target="_blank"><b><sup style="font-size:10px">[2]</sup></b></a> Timothy S. Gardner et al. Construction of a genetic toggle switch in Escherichia coli Nature 403, 339-342 (20 January 2000)</p><br><br />
<p><br />
<a name="ref3"></a><br />
<a href="http://www.cell.com/retrieve/pii/S0092867403003465"target="_blank"><b><sup style="font-size:10px">[3]</sup></b></a> Mariette R. Atkinson et al. Development of Genetic Circuitry Exhibiting Toggle Switch or Oscillatory Behavior in Escherichia coli Cell, Volume 113, Issue 5, 597-607, 30 May 2003 </p><br><br />
<p><br />
<a name="ref4"></a><br />
<a href="http://www.nature.com/emboj/journal/v17/n14/abs/7591108a.html"target="_blank"><b><sup style="font-size:10px">[4]</sup></b></a> Adam Platt and Richard J Reece The yeast galactose genetic switch is mediated by the formation of a Gal4p–Gal80p–Gal3p complex The EMBO Journal (1998) 17, 4086 - 4091 </p><br><br />
<p><br />
<a name="ref5"></a><br />
<a href="http://www.pnas.org/content/88/19/8597.abstract"target="_blank"><b><sup style="font-size:10px">[5]</sup></b></a> D W Griggs and M Johnston Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression PNAS October 1, 1991 vol. 88 no. 19 8597-8601</i></p><br />
<br />
</html></div>I.stansfieldhttp://2010.igem.org/Team:Aberdeen_Scotland/Project_OverviewTeam:Aberdeen Scotland/Project Overview2010-10-24T21:08:29Z<p>I.stansfield: </p>
<hr />
<div>{{:Team:Aberdeen_Scotland/css}}<br />
{{:Team:Aberdeen_Scotland/Title}}<br />
<html><br />
<h1>Project Overview</h1><br />
<br><br />
<h3>Introduction</h3><br />
<p> <br />
For this year’s iGEM competition the Aberdeen team has worked on developing a translationally controlled toggle switch embedded in yeast.<a href="#ref1"><sup style="font-size:10px">[1]</sup></a> Genetic toggle switches are a vital component for synthetic biology circuits , enabling functional control of biological functions. The majority of toggle switches used for iGEM are embedded in Escherichia coli and can only be controlled at the transcriptional level <a href="#ref2"><sup style="font-size:10px">[2]</sup></a><sup style="font-size:10px">,</sup><a href="#ref3"><sup style="font-size:10px">[3]</sup></a>. Our main goal was to create and model a novel gene circuit, wherein yeast cells can be switched between mutually exclusive fluorescent proteins under exposure to environmental factors. This switching behaviour would be regulated at the translational level, an innovation over previous systems that only demonstrated transcriptional regulation <a href="#ref4"><sup style="font-size:10px">[4]</sup></a><sup style="font-size:10px">,</sup><a href="#ref5"><sup style="font-size:10px">[5]</sup></a>.The novel genetic toggle switch operated by controlling gene expression at the translational level consisted of two gene expression constructs expressing an RNA-binding protein fused to either Green (GFP) or Cyan (CFP) fluorescent protein in the presence of appropriate inducer. When co-expressed in yeast, these translational fusions would be mutually inhibitory at the translational level, thereby forming a biological, ‘Toggle Switch’ system. <br />
</p><br />
<br><br />
<br />
<h3>The AyeSwitch</h3><br />
<p>The toggle switch is shown by Fig 1 and was named the ‘AyeSwitch’. It is regulated by controlling the two constructs, GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP], via inducible yeast promoters GAL1 or CUP1 in the presence or absence of galactose and Cu2+ ions respectively. <br />
</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/f/ff/Toggle_switch.jpg"><br />
</center><br />
<br><br />
<p><br />
For example, in the presence of galactose only, GAL1 is induced and there is expression of N-peptide-GFP protein. The subsequent addition of Cu2+ then induces the transcription of mRNA coding for MS2 coat binding protein and CFP. In addition to this, the mRNA also codes for a Bbox stem loop sequence that can be bound by N-peptide. </p><br />
<p><br><br />
Ideally, there is initial inhibition of MS2-CFP translation by Npeptide-GFP binding to the Bbox stem loop. Evolution of time corresponds to the ratio of MS2-CFP mRNA to N-peptide-GFP protein increasing allowing some MS2-CFP to be produced until CFP ‘switches ON’ as it gains dominance over GFP.</p><br />
<p><br />
Additionally, N-peptide-GFP protein translation can also be inhibited by MS2-CFP via MS2 protein binding to the MS2 stem loops on the N-peptide-GFP mRNA. This may help the switching ON of CFP and also means GFP would face a similar situation if the inducer was changed from Cu2+ to galactose.</p><br />
<p><br><br />
However, additional variables may come into play affecting the outcomes described above. It is likely that the concentration of each inducer present, the translational rate and binding efficiency of stem loop binding proteins to mRNA stem loop and degradation rate of proteins can also affect the outcome. Reversing the order of inducer present may also affect the outcome. </p><br />
<br><br />
<br />
<h3>Experimental Characterisation of the AyeSwitch</h3><br />
<p><br />
The experimental work addressed these issues by initially characterising the promoters in terms of their dose response and time response using constructs GAL1-[GFP] and CUP1-[GFP]. These experiments were then extended to characterise GAL1p-[Npeptide-GFP] and CUP1p-[MS2-CFP] which discovered that CUP1p-[MS2-CFP] did not function as expected.</p><br><br />
<p><br />
The experimental work diverged from this point to troubleshoot CUP1p-[MS2-CFP], investigating the translation inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein using construct MET17p - [MS2], Bio-brick construction and testing of Bio-brick E2050 mOrange.</p><br />
<br><br />
<br />
<h3>Troubleshooting CUP1p-[MS2-CFP]</h3><br />
<p><br />
Troubleshooting of CUP1p-[MS2-CFP] was carried out through a series of gene cassette replacement experiments testing the promoter and CFP sequences for functionality. The conclusions to these experiments suggest that the Bbox Stem loop, usually located in the 3’untranslated region but is in the 5’ untranslated region of our construct may be preventing the expression of downstream proteins. It may also be that the fusion of MS2 to CFP results in inappropriate protein folding, inhibiting expression.</p> <br />
<br><br />
<br />
<h3>Verification of Translation Inhibition as a Regulatory Mechanism</h3><br />
<p><br />
It was shown that the translational inhibition of GAL1p-[Npeptide-GFP] by MS2 coat protein was possible, confirming that translational regulation is viable. Further work if time permitted would investigate if this inhibition could work in the context of a toggle switch.</p><br />
<br><br />
<br />
<h3>Bio-brick construction and testing </h3><br />
<p><br />
In parallel, Bio-bricks were constructed and submitted to the Registry of parts whilst testing of the Bio-brick E2050 mOrange using fluorimetry and FACS analysis lead to the conclusion that the mOrange sequence did not function within our GAL1p-[Npeptide-GFP] construct that was shown to be able to express GFP appropriately. </p><br />
<br><br><br />
<hr><br />
<h1>Attribution and Contributions</h1><br />
<h3>Biological circuit construction and testing </h3><br />
<p><br />
<h3>Mathematical modelling of the AyeSwitch </h3><br />
<p><br />
<table class="nav"><br />
<tr><br />
<td><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Home</a><br />
</td><br />
<td align="right"><br />
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Team">Continue to iGEM at Aberdeen&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a><br />
</td><br />
</tr><br />
</table><br />
<hr><br />
<br><br><br />
<h3> References</h3><br><br />
<p><br />
<a name="ref1"></a><br />
<a href="http://www.nature.com/msb/journal/v2/n1/full/msb4100073.html"target="_blank"><b><sup style="font-size:10px">[1]</sup></b></a> Ernesto Andrianantoandro et al. Synthetic biology: new engineering rules for an emerging discipline Molecular Systems Biology 2:2006.0028</p><br><br />
<p><br />
<a name="ref2"></a><br />
<a href="http://www.nature.com/nature/journal/v403/n6767/abs/403339a0.html"target="_blank"><b><sup style="font-size:10px">[2]</sup></b></a> Timothy S. Gardner et al. Construction of a genetic toggle switch in Escherichia coli Nature 403, 339-342 (20 January 2000)</p><br><br />
<p><br />
<a name="ref3"></a><br />
<a href="http://www.cell.com/retrieve/pii/S0092867403003465"target="_blank"><b><sup style="font-size:10px">[3]</sup></b></a> Mariette R. Atkinson et al. Development of Genetic Circuitry Exhibiting Toggle Switch or Oscillatory Behavior in Escherichia coli Cell, Volume 113, Issue 5, 597-607, 30 May 2003 </p><br><br />
<p><br />
<a name="ref4"></a><br />
<a href="http://www.nature.com/emboj/journal/v17/n14/abs/7591108a.html"target="_blank"><b><sup style="font-size:10px">[4]</sup></b></a> Adam Platt and Richard J Reece The yeast galactose genetic switch is mediated by the formation of a Gal4p–Gal80p–Gal3p complex The EMBO Journal (1998) 17, 4086 - 4091 </p><br><br />
<p><br />
<a name="ref5"></a><br />
<a href="http://www.pnas.org/content/88/19/8597.abstract"target="_blank"><b><sup style="font-size:10px">[5]</sup></b></a> D W Griggs and M Johnston Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression PNAS October 1, 1991 vol. 88 no. 19 8597-8601</i></p><br />
<br />
</html></div>I.stansfield