Team:NYMU-Taipei/Project/Speedy reporter/Materials and Methods

From 2010.igem.org

Fusion Protein

GFP

We based splitting GFP ([http://partsregistry.org/Part:BBa_E0040 BBa_E0040]) based on the split point at 157&158aa used by iGEM07_Davidson_Missouri's [http://partsregistry.org/Part:BBa_I715019 BBa_I715019] and [http://partsregistry.org/Part:BBa_I715020 BBa_I715020]. The A-part split is the same as [http://partsregistry.org/Part:BBa_I715019 BBa_I715019], but the B-part has one base difference from [http://partsregistry.org/Part:BBa_I715020 BBa_I715020].

FP (including start codon): atgcgtaaaggagaagaacttttc (55c,24bp,38gc)
RP: ttgtttgtctgccatgatgtatac (55c,24bp,38gc)

FP: aagaatggaatcaaagttaacttcaaaa (55c,28bp,25gc)
RP (excluding stop codon): tttgtatagttcatccatgccatg (55c,24bp,38gc)

RFP

We based splitting RFP ([http://partsregistry.org/Part:BBa_E1010 BBa_E1010]) based on the split point at 154&155aa used by iGEM07_Davidson_Missouri's [http://partsregistry.org/Part:BBa_I715022 BBa_I715022] and [http://partsregistry.org/Part:BBa_I715023 BBa_I715023]. The A-part split is the same as [http://partsregistry.org/Part:BBa_I715022 BBa_I715022], but the B-part has one base difference from [http://partsregistry.org/Part:BBa_I715023 BBa_I715023].

FP (including start codon): atggcttcctccgaagac (55C,18bp,56%)
RP: gtcttccgggtacatacgtt (55C,20bp,50%)

FP: ggtgctctgaaaggtgaaatc (55C,21bp,48%)
RP (excluding stop codon): agcaccggtggagtga (56C,16bp,63%)

eIF4A

We split eIF4A ([http://partsregistry.org/Part:BBa_K411100 BBa_K411100]) at 215&216aa based on Natalia E. Broude's study. But first we needed to mutate the two PstI cutting sites.

We took the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found it had 2 PstI cutting sites:

We need to mutate out the two PstI cutting sites. The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by C.Proud. We used these primers to mutate the cutting site:

2 of pstI cutting site
mut1(24bp,55C,42%)
FP: ccatatcaattctccagcagattga
RP: caatctgctggagaattgatatggc
mut2(18bp,55C,56%)
FP: gcagaagctccagatggaa
RP: tccatctggagcttctgca

The new sequence after mutation:

FP: atggagccggaaggcgtcatcga (66c,24bp,61gc) [design error -- was suppose to design it to be 55c]
RP: agggtctctcataaatttcttgg (54C,23bp,39%)

FP: attcggattcttgtcaagaagg (54C,22bp,41%)
RP (including stop codon): tcaaatgaggtcagcaacgttgag (59c,24bp,46gc) [design error -- was suppose to design it to be 55c]

Linker

We took the linker from 2.protocol file from Natalia E. Broude.

We decided to use primers to create the linker:

        cggcagcagcggcagcggcagc
ggcagcagcggcagcagcggcagcggcagc
ggcagcagcggcagcagcggcagc
overlapping region: cggcagcagcggcagc (63c,16bp,81gc)
FP: cggcagcagcggcagcggcagc (22bp)
RP: gctgccgctgctgccgctgctgcc (24bp)

Fusioning it together

GFP fusion part

(note the extra taa stop codon at the end)

GFP_split_A_FP: gaattcgcggccgcttctagag atgcgtaaaggagaagaacttttc (46bp) OK
GFP_split_A_RP: gctgccgctgctgccgctgctgcc ttgtttgtctgccatgatgtatac (48bp) RE DING
eIF4A_split_A_FP: cggcagcagcggcagcggcagc atggagccggaaggcgtcatcga (45bp) OK
eIF4A_split_A_RP: ctgcagcggccgctactagta tca agggtctctcataaatttcttgg (47bp) OK

(note that we added as start codon and removed the stop codon of GFP_B)

GFP_split_B_FP: gaattcgcggccgcttctagag atg aagaatggaatcaaagttaacttcaaaa (53bp)
GFP_split_B_RP: gctgccgctgctgccgctgctgcc tttgtatagttcatccatgccatg (48bp)
eIF4A_split_B_FP: cggcagcagcggcagcggcagc attcggattcttgtcaagaagg (44bp)
eIF4A_split_B_RP: ctgcagcggccgctactagta tcaaatgaggtcagcaacgttgag (45bp)

RFP fusion part

(note the extra taa stop codon at the end)

RFP_split_A_FP: gaattcgcggccgcttctag atggcttcctccgaagac (38bp)
RFP_split_A_RP: gctgccgctgctgccgctgctgcc gtcttccgggtacatacgtt (44bp)
eIF4A_split_A_FP and RP are the same as the GFP part above.

(note that we added as start codon and removed the stop codon of RFP_B)

RFP_split_B_FP: gaattcgcggccgcttctag atg ggtgctctgaaaggtgaaatc (44bp)
RFP_split_B_RP: gctgccgctgctgccgctgctgcc agcaccggtggagtga (40bp)
eIF4A_split_B_FP and RP are the same as the GFP part above.

Aptamer

• Aptamer in front of non-coding sequence:
  • 

    RNAfold prediction of Aptamer Structure with Biobrick scars in front of a non-coding region. The scars bond together, but the overall structure does not change.
• Check to see if the addition of the biobrick scars affect the secondary structure in front of coding sequence:
  • 

    RNAfold prediction of Aptamer Structure with Biobrick scars in front of a coding region. The scars bond together, but the overall structure does not change.
• Structure interacting with the split proteins:
  

  Aptamer Structure interacting with split protein [6]