Team:Harvard/allergy/notebook

From 2010.igem.org

Revision as of 05:27, 24 October 2010 by Anugraha (Talk | contribs)



notebook calendar

Week 1 06-14-2010 06-15-2010 06-16-2010 06-17-2010 06-18-2010
Week 2 06-21-2010 06-22-2010 06-23-2010 06-24-2010 06-25-2010
Week 3 06-28-2010 06-29-2010 06-30-2010 07-01-2010 07-02-2010
Week 4 07-06-2010 07-07-2010 07-08-2010 07-09-2010
Week 5 07-12-2010 07-13-2010 07-14-2010 07-15-2010 07-16-2010
Week 6 07-19-2010 07-20-2010 07-21-2010 07-22-2010 07-23-2010
Week 7 07-26-2010 07-27-2010 07-28-2010 07-29-2010 07-30-2010
Week 8 08-03-2010 08-04-2010 08-05-2010 08-06-2010
Week 9 08-09-2010 08-10-2010 08-11-2010 08-12-2010 08-13-2010

06-14-2010 [ top ]

06-15-2010 [ top ]

06-16-2010 [ top ]

06-17-2010 [ top ]

06-18-2010 [ top ]

Progress

  1. Identified allergens in arabidopsis, strawberries,tomatoes, and carrots and created primers for amplifying out these allergens (see primers and sequences)]
  2. Extracted cDNA (rna extraction followed by rt-pcr) from strawberries and tried to PCR out our strawberry allergen (Fra a 1), but were unble ato do so
  3. Looked to find introns ~ 800 bp to use to create our hairpins since it was difficult to acquire pHannibal vector w/ the pdk intron

Future Directions

  1. Look towards ordering amiRNAfor silencing
  2. Waiting on arabidopsis plants to grow to extract genomic DNA (mon)
  3. Look to find introns to use in creation of hairpin DNA
  4. Cloning (digesting/ligating our sense/antisense/intron sequences necessary for hairpin creation into one vector to create biobricks)

06-21-2010 [ top ]

  • PCR amplification of gDNA from Arabadopsis thaliana for sense and antisense parts of LTP, Bet v 1, and Ger3.
  • Diagnostic Digest of PCR products

Results

6.17.jpg

Lane 2 is LTP sense, lanes 11 and 12 are Ger 3 sense and antisense.

06-22-2010 [ top ]

  • Gel electrophoresis of PCR products
  • Gel digest and purification of LTP sense, Ger sense and Ger antisense
  • Digest with Xba and Pst
  • Purification of parts


Results
Gel purification yielded 2.6, 7.8, and 7.9 ng/μL of LTP sense, Ger sense, and Ger antisense parts. We were able to obtain 1.5, 4.3 and 0.5 ng/μL of digested LTP sense, Ger 3 sense, and Ger 3 antisense, respectively, from the digest purification.

06-23-2010 [ top ]

  • Digest and purification of vector V0120
  • Ligation of LTP sense, Ger sense, and Ger antisense parts into V0120

Results
Ligations were plated.


06-24-2010 [ top ]

06-25-2010 [ top ]

06-28-2010 [ top ]

06-29-2010 [ top ]

06-30-2010 [ top ]

07-01-2010 [ top ]

  • Ligations for full amiRNA and V0120 (w/o death gene)

note: .5 denotes multistep pcr reaction from yesterday in which .5 uL of part 3 of gfp/ltp were use in one of the giant assemblies of parts 1,2,3 w/ primers A&B

Ligation Reactions
Bet GFP LTP LTP(.5) GFP(.5)
DNA Insert (after 1:10 dilutions) 3 4.5 3 4.71 4.1
T4 DNA ligase buffer (10x) 2 2 2 2 2
diH2O 11.5 10 11.5 9.79 10.4
T4 DNA ligase 1 1 1 1 1
DNA Backbone 2.5 2.5 2.5 2.5 2.5
    • Used 50 ng of backbone and 150 ng of insert (ratio of insert to vector ~.14
    • Did 1:10 dilutions for the digested inserts


  • PCR of PME3 and PAL2
    • saw no bands from last night's pcr so we re ran it

Annealing Temp: 69C Extension Time: 30 sec

2 reactions (PME & PAL)

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
Arabadopsis Genomic DNA 1
Fwd/Rev Primer .5 uM each (1uL 50x)
Water 35.5

Concentrations: PME: 250 ng/uL PAL: 134 ng/uL

  • gel: lane 1:ladder; lane 2: Pal3; lane 3: Pme 2; lane 4: ladder

Pal 2 and Pme 3 introns

  • Sent amiRNA Bet for sequencing
  • Ligation of Antisense/sense allergens into V0120 (lacking death gene)
Ligation Reactions
BetS BetA LTPS LTPA GerS GerA Bet 1.2S Bet 1.2 A Negative Control
DNA Insert (after 1:10 dilutions) ~ 3 times excess 3 3 3 3 3 3 3 3 0
T4 DNA ligase buffer (10x) 2 2 2 2 2 2 2 2 2
diH2O 12 12 12 12 12 12 12 12 15
T4 DNA ligase 1 1 1 1 1 1 1 1 1
DNA Backbone 2 2 22 22222
    • Used 34 ng of backbone and 10 ng of insert (ratio of insert to vector ~.09375

07-02-2010 [ top ]

  • Check on sequences for Bet
  • Digest Pme3 and Pal 2 introns/Ligate w/ V0120/Transform
    • Digestions
Digestion Reactions
PME 3 (4 digestions) Pal 2 (4 digestions) Backbone (B21 w/ YFP)
DNA 4 (~1000ng)7 (~1000ng) 3 (~900 ng)
FD Buffer (10x) 2 2 2
diH2O 12 9 13
EcoRI 1 1 1
SpeI 1 1 1
    • PCR purified digests
      • Concentrations: Pme (ranges from 20-36 ng/uL); Pal (ranges from 20 to 28 ng/uL)
    • Ran backbone on gel and gel purified (Concentration: 3.1 ng/uL)
  • Ligations of Pme/Pal w/ V0120
Ligation Reactions
Pme4 Pal3 Pme5 Pal1
DNA Insert 1.85 1 1 4.86 after 1 in 10 dilution
T4 DNA ligase buffer (10x) 2 2 2 2
diH2O 14.15 15 6.3 --
T4 DNA ligase 1 1 1 1
DNA Backbone 1 (bbone 2) 1 (bbone 2) 14 9.64
    • bbone 2 was potentially contaminated at a higher concentration 96.1 ng/uL
  • Check on transformations of amiRNA (5 transformations) and antisense/sense allergens (8 transformations)
    • There were colonies from the amiRNA transformations
      • We grew up 24 colonies (3 for each GFP, GFP .5, LTP, LTP .5, BET) ~ 10 am to be ready ~3 pm for minipreps)
      • The other 8 transformations did not show any colonies--we put it back in to see if we would get colonies (only 100 uL instead of 200 uL was plated)
      • To do: Grow up colonies to miniprep, run on gel, sequence
  • pHannibal and pKannibal arrived today (hannibal is amp resistant and kannibal is kan resistant)
    • We transformed these plasmids


07-06-2010 [ top ]

Team Allergy

Today, we isolated plasmid that contained antisense and sense sequences of the allergen panel and introns PME and PAL that we grew last week.

Procedures

For amiRNA

  1. Nanodrop of miniprepped amiRNA plasmids
  2. Diagnostic digest of amiRNA plasmids
  3. E Gel of digested amiRNA
  4. Send plasmids to Genewiz for sequencing

For ihpRNA

  1. Miniprep of plasmids containing introns for hpRNA
  2. Nanodrop of miniprepped intron plasmids
  3. Miniprep of plasmids containing Allergen Panel sense and antisense
  4. Nanodrop of minipreped allergen plasmids
  5. Diagnostic Digest of introns and allergens
  6. E Gel of digested parts
  7. Extract pKannibal and pHannibal vectors and transform into E. coli
  8. PCR of the PDK intron in pKannibal and pHannibal

Results

For amiRNA

Miniprep of turbo bacteria for plasmids containing sequences for amiRNA

Should obtain plasmids containing the complete sequence for amiRNA. The resulting concentration should be relatively high (<100ng/μL) because all growing bacteria would have the plasmids inside.

Nanodrop of miniprepped amiRNA plasmids

We used 2μL of DNA per nanodrop.

Concentrations in ng/μL
Sample # --> One Two Three
GFP 134.4167.6 207.2
GFP 0.5 163.3 106.9 230.9
LTP 134.0 127.8 165.5
LTP 0.5 158.5 137.2 113.5
Bet 129.4 78.9 124.4

Diagnostic digest of amiRNA plasmids Digested 200~500ng of plasmids with EcoR1 and Spe1. We will then run the digested vectors on an E Gel and look for DNA that is the length of the insert. If such DNA appears on the gel, then we will send it off to be sequenced.

E Gel of digested amiRNA

Image of E Gel plates two and one

We had to run 21 samples, so we used two gels. The orders were:

Gel #1

  1. 1kb Ladder
  2. GFP 1
  3. GFP 2
  4. GFP3
  5. GFP 0.5 1
  6. GFP 0.5 2
  7. GFP 0.5 3
  8. LTP 1
  9. LTP 2
  10. LTP 3
  11. LTP 0.5 1 no visible band for neither plasmid nor insert
  12. LTP 0.5 2

Gel #2

  1. 1kb Ladder
  2. LTP 0.5 3
  3. Bet 1
  4. Bet 2
  5. Bet 3
  6. Neg Control for hpRNA (digested with Xba and Pst, and ligated without new inserts) no visible insert band
  7. Neg Control for intron (digested with Eco and Spe, and ligated without new inserts)
  8. PME Good no visible insert band
  9. PME Dubious no visible insert band
  10. PAL Good colony 1 no visible insert band
  11. PAL Good colony 2
  12. 1kb Ladder

For ihpRNA

Miniprep of plasmids containing introns for hpRNA Nanodrop of miniprepped intron plasmids

We used 2μL of DNA per nanodrop.

Concentrations in ng/μL, cells are filled when applicable
Insert Name Good Dubious Colony 1 Colony 2 Colony 3
PME 85.666.8
PAL 67.7 108.8
Neg Control, Intron 74.0
Neg Contron, hpRNA 63.5 30.1 37.3
  1. Miniprep of plasmids containing Allergen Panel sense and antisense (from overnight cultures)--still need to do preps of cultures grown today
  2. Nanodrop of minipreped allergen plasmids
  3. Diagnostic Digest of introns and allergens
  4. E Gel

Gel #1

Lane 1: 1kb Ladder

Lanes 2-4: Ger Sense

Lanes 5-7: Ger Antisense

Lanes 8-10: LTP Sense

Lanes 11-13: LTP Antisense

Lanes 14-16: Bet 2 Sense

Lanes 17-19: Bet 2 Antisense

Lanes 20-22: Bet 1 Sense

Lanes 23-25: Bet 1 Antisense


phannibal and pkannibal Extracted vectors from a piece of paper per instructions. Transformed vectors into E. coli. Miniprep and PCR to extract PDK intron.

  • pcr to get out pdk intron

07-07-2010 [ top ]

Yesterday, we ended by transforming pKannabil and pHannibal into E. coli and running a diagnostic digest of digested allergen panel. Yesterday's plates did not grow, and the diagnostic digest did not have good results.

  • Today, we will be redoing diagnostic digests of the allergen panel plasmids to see if we can see our desired bands (300 bp and 3200) and re-transforming pKannabil and pHannibal.
    • If the digested allergen panel runs correctly on a gel, then we will send the plasmids off for sequencing.
    • If nothing gel does not run correctly, then we will go back to re-digest V0120 with a death gene insert instead of YFP and ligate allergen inserts, transform, miniprep, and see if we get the correct insert. **If some run correctly and some did not, we will collect more samples from our culture plates for the allergens that did not work and redo the digests until we find a sample with the correct plasmid.
  • If the pKannabil and pHannibal plates grow, then we will miniprep to purify the plasmids containing the PDK intron, PCR the intron, and purify the intron.
  • Today, we are also running the PDK intron obtained yesterday to see if it is the correct length.

First thing tomorrow, we will culture E. coli containing plasmids for our allergen panel to obtain more plasmids.

Procedures

For pKannabil and pHannibal:

  1. Electronic Gel Electrophoresis of PDK introns (from PCR reaction yesterday, PCR off DNA from the eluted vectors)
  2. Re-grow E. coli containing pKannabil and pHannibal plasmids
  3. Culture colonies
  4. Miniprep colonies
  5. PCR for PDK intron
  6. Diagnostic Gel to check for correct length
  7. Repeat PCR of PDK intron using different Tm (gradient pcr)

For Allergen panel

  1. Digest of Plasmids containing allergen inserts
  2. Diagnostic Gel
  3. Collect additional samples for allergens that did not work


Results

For pKannabil and pHannibal

Transformation of pHannibal pKannibal

This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate).

Quick and Dirty Transform:

  1. Mix
    1. 2ul 10x {pHannibal, pKannibal}
    2. 20ul Turbo E. Coli
    3. 220ul SOC Broth
  2. Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow

PCR of PDK intron

  • PCR of PME3 and PAL2
    • saw no bands from last night's pcr so we re ran it

Annealing Temp: 69C Extension Time: 30 sec

2 reactions

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
Arabadopsis Genomic DNA 7 ng
Fwd/Rev Primer .5 uM each (1uL 50x)
Water 35.5

Concentrations: PDK:46.5 ng/uL & 36.5 ng/uL Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3: 

OLIGO            start  len      tm     gc%   any    3' seq 

LEFT PRIMER       4229   20   51.11   30.00  8.00  3.00 CCAATTGGTAAGGAAATAAT
RIGHT PRIMER      5021   20   61.95   45.00  6.00  0.00 TTCGAACCCAATTTCCCAAC


See Gel Image Below: ladder, lane 3 and 5 are pdk intron


lanes 3 and 5 correspond to the pdk intron


Gradient PCR

Annealing Temps: 50,55,60,65

Extension Time: 30 sec

8 reactions

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
Arabadopsis Genomic DNA 7 ng
Fwd/Rev Primer .5 uM each (1uL 50x)
Water 35.5


Concentrations: PDK: 12.7 ng/uL

Remaining steps

  1. Culture colonies
  2. Miniprep colonies
  3. PCR for PDK intron
  4. Diagnostic Gel to check for correct length
  5. Repeat PCR of PDK intron using different Tm.

For Allergen panel

Digest of Plasmids containing allergen inserts

Digested with Xba and Pst using Fast Fermentas digest protocol. Added 3 μL of DNA and 17μL of master mix (with 0.5μL of each restriction enzyme) to each reaction.

Diagnostic Digest

    • Digestions
Digestion Reactions
LTPS (3) LTPA (3) GRES (3)GREA (3) Bet1SBet1ABet1.2S Bet1.2A
DNA (~200 ng) (~200 ng)|align="center" | (~200 ng)|align="center" | (~200 ng)|
FD Buffer (10x) 2 2 2 2
diH2O x x x x
Xba1 1 1 1 1
Pst1 1 1 1 1
    • Ran on a gel

240 px

Out of the 24 lanes, 6 were successful. Of the 8 allergens, 3 were successful. Samples of LTP sense, Betv1 sense, and Ger sense had one band at around 3kbps and one band at 300bps. The other genes had one band at 3kbps and additional longer bands on the scale of twice or three times the length of the plasmid.

For the allergens that did not work, we will go back to our bacteria plates and sample 5 additional colonies for each allergen, grow up 10 mL overnight cultures, and miniprep so that we can redo the diagnostic digest. We are hoping that a larger sample size would allow us to find colonies with the correct plasmid.

Remaining Steps

  1. Collect additional samples for allergens that did not work
  2. Culture them
  3. Miniprep
  4. Diagnostic Digest and Gel

07-08-2010 [ top ]

amiRNA

  • Sent out plasmids for sequencing w/ new primers

Allergen Panel

  • Sent out for sequencing this morning using new primers
  • Minipreps of Allergen Panel
    • Concentrations:

LTP 1,2,3: 265.5 ng/uL, 507.1 ng/uL, 275.5 ng/uL;

GerA 1,2,3,4: 283.1 ng/uL, 185.9 ng/uL, 182.4 ng/uL, 314.7 ng/uL;

Bet 2A 1,2,3,4: 246.6 ng/uL, 251.4ng/uL, 550.3 ng/uL, 235.8 ng/uL;

Bet 2S 1,2,3,4,5,6: 613 ng/uL, 296.8 ng/uL, 333.1 ng/uL, 467.3 ng/uL, 230.3 ng/uL, 129.4 ng/uL;

Bet 1A 1,2,3,4,5: 505.8 ng/uL, 632.1 ng/uL, 561.7 ng/uL, 594.4 ng/uL, 609.2 ng/uL

  • Diagnostic Digest

Allergen Panel after 40 min.jpg

PDK intron

  • Gradient PCR of PDK intron

PHAN+pKAN PDK PCR.jpg

lanes using 50 & 55 C worked

Gel of gradient PCR of the 741bp PDK intron out of pHANNIBAL and pKANNIBAL. Lanes are (left to right, temperatures are annealing temperatures used in the gradient PCR) 1kb+ ladder, pHAN 50ºC, pKAN 50ºC, pHAN 55ºC, pKAN 55ºC, pHAN 60ºC, pKAN 60ºC, pHAN 65ºC, pKAN 65ºC.

It appears that pHANNIBAL worked at 50, 55ºC but pKANNIBAL didn't.

Concentration: hannibal pdk 12.7 ng/uL kannibal pdk: 15.6 ng/uL

Did a PCR of the PCR product

Annealing Temps: hannibal pdk (50 C); kannibal pdk (55 C)

Extension Time: 30 sec

12 reactions (6 hannibal pdk; 6 kannibal pdk)

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
pdk 1 uL DNA (12.6 and 16.5 ng)
Fwd/Rev Primer .5 uM each (1uL 50x) at .5 uM
Water 35.5


  • Growing up 5 mL cultures of pHannibal and pKannibal for getting more DNA for pdk pcr
    • Gel purifying/digesting/ligating/transforming pdk intron into e.coli

07-09-2010 [ top ]

  • PCRd pHAN.pdk, pKAN.pdk (they're the same 741bp pdk) using the values that worked in the gradient, got them in high ODs. Put them in box a2 rows 3-4.
Concentration of PCR products in ng/ul
Temp(ºC) Source Label Concentrations
55 H HPDK55 64.0,190.9,66.4
50 H HPDK50 119.3,125.5,92.4
55 K KPDK55 84.3,97.3,106.5
50 K KPDK50 52.5,93.5,71.0

07-12-2010 [ top ]

Today, we received sequences for the allergen , intron, and amiRNA inserts. Since 4 of the 8 allergen inserts were not correctly done (and were not set for sequencing) and we want to repeat the inserts that DID work, we will redo ligations for the entire panel.

Procedures

  1. Check Sequencing Results
  2. Redo Ligations for allergen Panel

Results

Sequencing Results

  • amiRNA
    • GFP #1 & GFP.5 #3 worked
    • Bet,LTP did not work
  • intron
    • Pal(#2) matched
  • ihpRNA
    • LTP Sense 1,2,3 and Ger Sense 1 matched
    • Bet sense did not match

Full report (annotated sequences): File:Report.zip

Redo Ligations w/ phosphatized backbone for entire allergen panel,

PME did not grow, we will not use it since we have good PDK and PAL introns.

PAL and PDK will be digested and inserted into a plasmid containing a sense strand of an allergen.

Add PDK to amiRNA vectors if sequences match up

07-13-2010 [ top ]

Digestion

Digestion Reactions for Backbones (plasmids containing sense)
pLTPS1 pLTPS2 pLTPS3 GerS1
DNA 10 8 7 10
FD Buffer (10x) 2 2 2 2
diH2O 6 8 96
Spe 1 1 1 1
Pst 1 1 1 1
  • add phosphatase to backbone (15 min)
Digestion Reactions for Inserts
Pal2 PDK
DNA (~ 1 ug) 9
FD Buffer (10x) 2 2
diH2O 7
Xba1 11
Pst1 11
  • gel purify backbones LTPS: 8.7 ng/uL Ger: 9.4 ng/uL
  • pcr purify digested pdk: PDK1 14.4 ng/uL; PDK2 22.4 ng/uL; PDK3 11.4 ng/uL; PDK4 15.3 ng/uL

Ligations

Ligations of PDK w/ V0120 (lacking YFP)

Ligation Reactions
Pdk1 Pdk2 Pdk3 Pdk4
DNA Insert 2.36 2.981.52 2.22
T4 DNA ligase buffer (10x) 2 2 2 2
diH2O 12.6412.02 13.48 12.78
T4 DNA ligase 1 1 1 1
DNA Backbone (~50ng) 2uL 2uL2uL 2uL


Ligations of PDK/Pal into V0120 + Sense Allergens (LTP & GER)

Ligation Reactions 3:1 excess
PDK1 PDK2 PDK 3 PDK 4
DNA Insert (~36ng/ ~32 ng)) 2.51; 2.271.62;1.46 3.18; 2.86 2.37;2.13
T4 DNA ligase buffer (10x) 2 2 2 2
diH2O 8.49; 9.73 9.38; 10.54 7.82;9.14 8.63;9.87
T4 DNA ligase 1 1 1 1
DNA Backbone (~50ng/(~47ng) LTP1S 6; GerS 5 LTP1S 6; GerS 5 LTP1S 6; GerS 5LTP1S 6; GerS 5

07-14-2010 [ top ]

  • Genomic DNA extraction
    • PCR for allergen panel from genomic DNA
  • Grew up cultures of transformations from yesterday (LTPS+intron; GerS+intron; PDK+V0120)--tubes weren't cloudy so we grew overnight cultures again


8 reactions (Ger S/A; BetS/A; Bet1.2 S/A; LTP S/A)

Annealing Temp: 65 C Extension Temp: 30 sec

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
DNA 1 uL
AB primer mix (1x) 2.5
Water 35

Concentrations: BetS: 109.1 ng/uL; BetA: 90.5 ng/uL; GerS: 69 ng/uL; GerA: 46 ng/uL; LTPS:36.7 ng/uL; LTPA:5.2 ng/uL; Bet1.2S: 77.4 ng/uL; Bet1.2A:66.2 ng/uL; PME: 64.2 ng/uL; PAL: 62.9 ng/uL; PDK: 35.7 ng/uL; PDK(2): 81.3 ng/uL; PDK(3): 21.5 ng/uL



07-15-2010 [ top ]

Today, we did minipreps of intron and backbone. Would have also done minipreps of intron plus allergen part but none of those colonies grew.

We also miniprepped Betv1.2 Sense, Betv1.1 Sense, Bet 1.2 Antisense, and Ger Sense of the plates that we grew on Monday. The rest of the allergen panel did not grow properly. What colonies that WERE on the plate grew probably because AMP was not spread properly on the plate. We deduced this because those colonies could not grow in liquid media. We are waiting on more LB amp plates so that we can redo ligations, which is probably the reason for our lack of colonies.

We will do diagnostic digests of all miniprepped DNA.


Results

  • Minipreps of PDK+V0120 (LTPS+ PDK and Ger_S + PDK did not grow)
    • Made glycerol stocks 500uL of 80% glycerol + 500 uL cells
    • Concentrations of pPDK: 414.2 ng/uL; 478.8 ng/uL; 510.2 ng/uL; 119.2 ng/uL
      • Tomorrow, sending PDK+V0120 for sequencing
  • Looking at sequencing results for our other amiRNA parts
    • Only GFP worked from our first sequencing order. This time, none of the artificial parts had the right sequence
    • Repicking amiRNA colonies to miniprep (6 of each LTP, LTP 0.5, and Bet. We have correct GFP from our first sequencing order)
  • Minipreps of Bet 1S (2 colonies); Bet 1.2 S (1 colony); Bet 1.2 A (1 colony); Ger S (3 colonies)
    • Redoing Ligations & Transformations of Sense/Antisense Parts once we have LB + amp plates
    • Bet 1.1 S: 161 ng/uL & 199.2 ng/uL; Bet 1.2 A: 199.4 ng/uL; Bet 1.2S: 162.5 ng/uL
    • Concentrations of GerS: 347.7 ng/uL; 428.6 ng/uL 541.6 ng/uL
  • Diagnostic Digest of (PDK+V0120; GERS; BetS; Bet 1.2S/A)
Digestions
pPDK (1-4) pGERSPDK (1-3) Bet1S (2); Bet2S/A
DNA 1 1 1
FD Buffer (10x) 2 2 2
diH2O 15 15 15
Xba1 1 1 1
Pst 1 1 1
  • Ran on gel (Ladder, pdk, V0120 Backbone, Gers (1-3), Bet 1S (1,2), PDK (1-4), Bet 1.2 S, Bet 1.2 A

2010-07-15 16hr 33min.jpg

To send for sequencing: ger s, Bet 1S, PDK 2

  • Looking at PCR results for Allergen Panel from Genomic DNA that we extracted (did not work)

Ladder, GFPS, GFPA (These first two should not work), LTPS, LTPA, BetS, BetA, Bet2S, Bet2A, GerS, GerA, PME, PAL, PDK

IMG0001.tif

07-16-2010 [ top ]

More arabadopsis DNA arrived today. We are going to obtain more hpRNA parts and

  • Did a second PCR/Purification of our allergen panel from Julia's arabidopsis genomic DNA. It worked!

GFP didn't show up (first 2 lanes). The plants for the extraction weren't the GFP variety so this is expected.

Genomic dna pcr 2.jpg


  • gel purifying PCR products
    • Concentrations: LTPS: LTPA: GERS: GERA: BETS: BETA: BET2S: BET2A: PME: PAL:
  • Digested Xba1 Pst1
  • Sent BetS, PDK2, and GerS (3) for sequencing
  • Miniprep amiRNA

Nanodrop of Miniprepped amiRNA Concentrations

Concentrations in ng/μL of colonies 1~6
1 2 3 4 5 6
LTP 320.7 359.4 290.2 238.5 N/A 212.4
Bet 156.8 267.7 340.0 287.4 278.9 273.5
LTP 0.5 296.4 268.8 244.2 212.0 292.6 208.3

Diagnostic Gel: Ladder, Bet1-6, LTP1-LTP4, Ladder; Ladder, LTP6, LTP.5 (1-6), Ladder

AmiRNA d digest.jpg

07-19-2010 [ top ]

  • Got back sequencing results of GerS, BetS, PDK
    • All three samples of GerS and PDK sent in matched their corresponding sequences
  • Ran PCR of Friday's digested B21. The gel suggested a partial digest: we saw two bands of backbone where we should have seen only one:

Incomplete backbone digest.jpeg

  • Sending 6 samples of amiRNA (LTP.5), 5 samples of amiRNA (LTP), 6 samples of amiRNA (Bet)
  • Second digest of B21 appears to have been more successful:

Backbone digest confirmatio.jpg


Digestion Reactions
V0120
DNA ~2.1 ugrams
FD Buffer (10x) 2
diH2O 20-rest
Xba1 1
EcoRI 1
  • phosphatized backbone afterwards for 20 min after letting digestion run for an hour
  • concentrations
    • backbone: (5 copies each ~ 35 ng/uL)
    • Bet S/A:  ; Bet2S/A:  ; GerS/A:  ; LTPS/A:  ; PME:  ; Pal:
Ligation Reactions
BetS/A Bet2S/A LTPS/A GerS/GerA PmePal
diH2O 10-rest 10-rest 10-rest 10-rest 10-rest 10-rest
T4 DNA ligase buffer (10x) 1 1 1 1 1 1
DNA Insert 3 times excess 3 times excess 3 times excess 3 times excess 3 times excess 3 times excess
DNA Backbone ~50ng ~50ng ~50ng ~50ng ~50ng ~50ng
T4 DNA ligase 1 1 1 1 1 1
  • Ligated and transformed
    • allergen parts
    • Pme/pal

07-20-2010 [ top ]

Today, we plated the transformations that we did yesterday. We are also expecting sequences for amiRNA that we ordered yesterday.

Procedures

  1. Plating transformants
  2. Check sequences

Results

Plating Transformations One plate of each allergen S and A and the introns PAL and PME. All but BetS and PME had colonies

Sequencing Results for amiRNA

Not one matched the sequences that we wanted. The customization sequences that we wanted (our miRNA sequence+ a little bit of RS300) were not present in all of the LTP and Bet sequences sent in. Even the Biobrick ends were not present in the sequences except for GFP, from our earlier sequencing order.

What could have gone wrong? We suspect that the RS300 vector that was given to use already contains an interference sequence. The sequence that we used to design our primers are based on an RS300 vector without any inserted interference sequence. Christina has already sent an email to the lab that gave us the RS300 asking if the RS300 contains any interference, possibly GFP. That would explain our results.

It is possible that we will have to go back and redo PCR ~ transformation. These results are all still from the first time that we tried making amiRNA parts, just different colonies. 

"c1" and "c2" are the customization (mutagenesis) sites corresponding to the capitalized portions of the primers suggested by the WMD3 tool. 
"c1" corresponds to the capitalized region of what WMD3 calls primer3 and to the reverse compliment of the capitalized region of primer4. 
Similarly, "c2" corresponds to the capitalized region of primer1 and the reverse complement of the capitalized region of primer2. 
For instance, WMD3 gives us the following when asked to design primers for the BET sequence:
primer1:	gaTTGGTTATATATATCGCACCTtctctcttttgtattcc
primer2:	gaAGGTGCGATATATATAACCAAtcaaagagaatcaatga
primer3:	gaAGATGCGATATATTTAACCATtcacaggtcgtgatatg
primer4:	gaATGGTTAAATATATCGCATCTtctacatatatattcct

In the sequence itself, the 

File		c1 Seen			c2 Seen
----- First Sequencing Batch ------------
BETF-Fwd.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BETR-Rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
----- Second Sequencing Batch -----------
bet_2_f-forw	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
bet_3_f-forw	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT	
----- Third Sequencing Batch ------------
BET1F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET1R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET2F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET2R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET3F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET3R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET4F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET4R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET5F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET5R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET6F-f.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
BET6R-rev.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
LTP1F-fwd.seq	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
...
----- Theoretical Expectations ----------
RS300 Plasmid	TTGGACTGAAGGGAGCTCCC	GAGAGCTTCCTTGAGTCCAT
Bet.ape		AGATGCGATATATTTAACCAT	TTGGTTATATATATCGCACCT
GFP.ape		GTACAGCTCGCCGTCCACTAT	TTAGTGGTCGGCGAGCTGCAC
LTP.ape		GTAGTCCTATACAAAGTTAGT	TCTAACTATGTATAGGACCAC
RS300.ape	TATGGACTGAAGGGGACCCGT	ACAGGTCCCCTTCTGTCCATT
RS300 Backbone	TATGGACTGAAGGGGACCCGT	ACAGGTCCCCTTCTGTCCATT

07-21-2010 [ top ]

Yesterday, we plated transformants for the allergen panel and introns. Today, we will purify the plasmids from the transformants and send any successes in to Genewiz for sequencing.

Procedures

  1. Culture Colonies
  2. Miniprep of colonies
  3. Diagnostic Digest to check for inserts
  4. Send working colonies for sequencing

Results

Diagnostic Digest

lader; ladder; GerS (1-3); Ger A (1-3); Bet2S (1-3); Bet2A (1-3); BetA (!-3); LTPS (1-3); LTPA (1-3); Pal (1-3); ladder; ladder

Ddigestallergenpanel.jpg

(More contrasted image below):

AllergenPanel2DiagHC.jpg

07-22-2010 [ top ]

Today, we are expecting our sequencing results from Genewiz. Once those arrive, we will check the sequences for both the primers and the correct allergen sequence (around 300bps). If the sequences are correct, we will go back to our plasmids and cut the intron out of the plasmid and digest the plasmids containing the sense strands with S, P.

Procedures

  1. Check Sequencing Results
  2. Digest Intron with X, P
  3. Digest Plasmids with Sense with S,P
  4. Gel Electrophoresis of Digested Plasmids (both Intron and Sense)
  5. Gel Extraction and Purification of Intron and Antisense
  6. PCR purification of Sense + Bbone

Results

Sequencing Results

  • Ger S (all 3 samples had correct sequence)
  • Ger A (all 2 samples had correct sequence)
  • Bet 2S (#3 did not work. #2 had correct sequence)
  • Bet 2A (all 3 samples had correct sequence)
  • LTP S (all 3 samples had correct sequence)
  • LTP A (all 2 samples had correct sequence)
  • Pal (#3 did not contain plasmids. #1 and #2 had correct sequence)
  • PME and Bet v1.1 S did not grow up from the plates, so they were not included in sequencing.


Digest Intron with X, P Fast Fermentas protocol was used.

Digest Plasmids with S, P Fast Fermentas protocol was used.

Gel electrophoresis of Digested Plasmids We PCR purified the products of the digestion (unnecessarily), losing some DNA. Elution was done with 50μL of EB. Tomorrow, we will run the purified PCR products on a gel and Gel Extract and Purify.

07-23-2010 [ top ]

Today, we will create our very first biobrick vector with both the sense and intron parts. We will use parts digested yesterday, purify them, and ligate them together.

Procedures

  1. Gel Electrophoresis of Intron and Antisense
  2. Gel purification of Intron and Antisense inserts
  3. Ligation of Intron insert and Sense + V0120
  4. Transform and plate

Results

Gel Electrophoresis

Antisense cut w X P.jpg

All the Antisense and intron lanes showed, though the last lane (PAL) was faint.

Gel Purification Nanodrop of gel purification had concentrations of:

  • LTP: 1.8, 2.9
  • Bet v1.1: 6.0, 3.2
  • Bet v1.2: 1.8, 0.5, 1.3
  • Ger 3: 0.8, -0.5
  • Pal: 6.7, 0.7

There is some cause for concern for the lower concentrations, since these small numbers are outside of the range of accuracy.

Ligation of intron insert into Sense + V0120 PME was ligated into all backbones containing sense parts of the allergen panel (8 rxns), followed by PAL ligation into the same backbones. We plated two of each PAL ligation in case that there might be some increased chances of finding growth on plates if more than one plate is done for each ligation. We will check for colonies Saturday.

07-26-2010 [ top ]

Procedures

Last week, we finished ligation together Sense and Intron parts of the hpRNA and transformed them into E. coli. This week, we will extract the plasmids, add in the antisense part, and transform.

Procedures today...

  1. Culture colonies (done over the weekend)
  2. Miniprep of V0120 sense + PDK, PAL intron parts
  3. Diagnostic Digest

We also need to check which parts of the sequence on the team page corresponds to the sense/antisense parts of the gene. There may have been mistakes in the past.

Results

Culture We cultured 38 colonies. All grew but one LTP+PAL and Ger+Pal grew. We labeled the cultures 1- 38 for simplicity sake.

Miniprep

Here are the concentrations of the miniprepped plasmid.

Sample Number
1 2 3 4 5 6 7 8 9 10
LTP+PDK 233.9 507.6 498.7 510.0 485.1 588.3
LTP+PAL 471.8 586.7 500.2 449.4 492.7 430.0 521.8 605.8 499.1 299.9
Bet v1+PDK 430.1 519.3
Bet v1+PAL 432.3 300.6 458.7 213.8
Bet v2+PDK 270.3 223.3
Bet v2+PAL 270.3 223.3
Bet v2+PDK 270.3 223.3
Ger3+PDK 440.4 205.2 342.7 290.2
Ger3+PAL 335.4 297.8 474.3 396.1 354.7 366.2

Diagnostic Digest

We digested the vectors with Spe and Pst1 and ligate with antisense parts (already digested and gel purified). We ran them on the E Gel too long so the lanes do not show anything conclusive, other than that there is digested DNA in the bottom half.

Result: 2-assembly digest.jpg

Sequence review clarified which parts of the sequences on the team page corresponded to sense/antisense.

07-27-2010 [ top ]

Procedures

Yesterday, we tried to run a diagnostic digest of the Sense + Intron hpRNA. The gel did not work properly, so we are redoing the gel today. We'll also go ahead and ligate antisense parts into all 38 minipreps that we HOPE contains correct Sense + Intron. Once the gel finishes running, we can go back and dispose of the ligations today that do not contain the correct S+I parts.

Today, we are also going to redo the ligation of Sense + Intron for PDK colonies because the gel that we are redoing today suggests that no PDK worked from last week's ligation.

Procedures

  1. Diagnostic Digest
  2. Diagnostic Gel
    1. Diagnostic Gel of PDK + Sense
  3. Ligation of Antisense Part into 38 minipreps

Redoing ligations for Sense + PDK

  1. Digest of pLTP, pBet v1, pGer with S, P
  2. PCR purification
  3. Ligation of Sense+PDK
  4. Transform and Plate

Results

Diagnostic Digest

38 digests of the sense+intron miniprepped plasmid DNA. The digest was done with Slow Digest Eco and Pst

Diagnostic Gel

From the digest, we can see that two LTPS+Pal worked (9,11), 3 Ger3S+Pal worked (36-38), 4 Bet2S+Pal Worked (25-28)

Lanes are: 1-6: LTP + PDK (3200 & 1200);

7-16: LTP + PAL (3200 & 540);

17,18: Bet1 + PDK (3200 & 1200);

19-22: Bet1 + PAL (3200 & 540);

23,24: Bet2+PDK (3200 & 1200);

25-28: Bet2 + PAL (3200 & 540);

29-32: Ger3 + PDK (3200 & 1200);

33-38: Ger3 + PAL (3200 & 540);

Image: Ladder (every 6)

Ddigestrun2.jpg Ddigestrun3.jpg

Rerun of the lanes that were ligations of PDK + sense because they did not show on the gel above. We feel that there might be a chance that if the Sense+PDK assembly did not work, the 300bp evidence ran off the first gel. This second gel shows that most of the PDK+sense did NOT work. Only three worked -- minipreps 16, 30, and 31.

2-assembly-diagnost-L.jpg 2-assembly-diagnost-R.jpg


Ligated with antisense parts and transformed

Digested antisense parts with X, P and pSense+Intron with S, P. Digestion ran for 2 hours, with an additional 20 minutes to de-phosphatize the backbone. Ligations were done for colonies that showed correct Sense+Intron ligations.

1-39
DNA ~1.5 ug
10x BSA 3
diH2O Fill to 30
Spe 1.5
Pst1 1.5
Neb Buffer 2 (10x) 3

Transform and Plate

The standard Turbo Cell transformation protocol was followed.

Redo Ligations for PDK+ Sense

Since the gel showed that most of them did not work.

Digestion of pLTP, pBet v1, and pGer 3 with S, P to prepare them as a back bone. Phosphatase was used. Did not digest pBet v2 because there was not enough.

PCR purify the digested backbones containing Sense.

Nanodrop

pLTP - 24.0 pBet - 17.2 pGer - 42.8

Ligate predigested PDK digested with X, P and ligate into purified backbone. Transform and Plate (6? plates total)

07-28-2010 [ top ]

Procedures

Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation.

Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).

  1. Culture colonies
  2. Miniprep
  3. Nanodrop

For our false negatives

  1. Ligate
  2. Transform

Results

Nanodrop

The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron

  1. 9, LTP, 97.9, 94.1
  2. 11, LTP, 77.9, 94.8
  3. 25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks)
  4. 28, Bet v2, 73.2, 83.6
  5. 36, Ger3, 76.1, 83.4
  6. 37, Ger3, 70.0, 75.3
  7. 38, Ger3, 90.4, 108.3

Transformed more sense+pdk parts for our false negatives (16,30,31)

The parts already have been digested and purified, so today, all we had to do was ligate and transform.

07-29-2010 [ top ]

  • Ran a gel for our second attempt at amiRNA stiching (stage 1): AmiRNA stich2 stage1.jpg. It seems that the backbone is still present at high concentrations after PCR purification. Maybe this is why last time we had a high incidence of background? This time we're gel purifying.
  • Dignostic Digest

Gel: ladder, 9, 9, 11, 11, 25, 25, 28, 28, ladder, 36, 36, 37, 37, 38, 38, ladder, LTPS+ PDK, LTPS+PDK, Bet2S+PDK, Bet2S+PDK, GerS+PDK, GerS+PDK, GerS+PDK, GerS+PDK

Expected band lengths:

Complete Parts

9,11 (LTPS+Pal+LTPA): 840bp and 3200 bp

25,28 (Bet2S+Pal+Bet2A): 840bp and 3200 bp

36,37,38 (GerS+Pal+GerA): 840bp and 3200 bp

Sense + Intron Parts

LTPS+ PDK: 1200 and 3200 bp

Bet2S+ PDK: 1200 and 3200 bp

GerS+PDK: 1200 and 3200 bp

Ddigest complete parts.jpg

(9 c1, 25 c2, 36 c1 have a 540 and 3200 band as opposed to a 840 and 3200 band--prbly b/c sense+intron is there but antisense was not ligated in). All intron+sense parts except for LTPS+PDK appear to have 300 bands as well indicating that PDK was not ligated in.

(a small mix up with two of the lids was made and its possible that LTPS+PDK (w/ an 840 and 3200 band is actually the complete Bet2 part so we're sending this in for sequening anyway).

07-30-2010 [ top ]

  • Sequencing Results:

LTP ihpRNA parts that worked: 9c2, 11c1, 11c2

Bet 2 ihpRNA parts that worked: 25c1,c2, 28c1,(LTPS+PDK is actually Bet 2 hpRNA)

Ger ihpRNA parts that worked: 36c1,c2, 37c1,2, 38c1,c2


08-03-2010 [ top ]

  • Grew up cultures of completed ihpRNA constructs (Bet, LTP, Ger) in pORE expression vector
  • amiRNA PCR
    • Will look at results of PCR tommorrow

08-04-2010 [ top ]

Tasks

  • amiRNA PCR appears to have worked at every Tm we tried:

AmiRNA-try-3.jpgAmiRNA pcr 8.3.jpg


  • Digested V9/V10 to insert our constructs into
    • Realized that we hadn't gel purified our ihpRNA inserts
    • Gel purification of inserts (entire ihpRNA parts)

Gel 1

Ladder, 9, 11c1, 11c2, ladder, 25c1, 28c1, 28c2, 36c1, 36c2, ladder

Results

  • Successfully gel purified our inserts and digested backbones that we will ligate into

08-05-2010 [ top ]

  • Gel extracted V9/V10 backbone

V9v10.jpg

Lanes: Ladder, V9, Ladder, V10

Concentrations: V9 (9.4 ng/uL; V10 (16.4 ng/uL)

  • Ligated ihpRNA inserts into V9/V10 and transformed
    • For our ligations we only used ~ 2uL of backbone (around 18 and 32 ng of backbone)and used a 3x excess of insert
  • Verified that amiRNA stitching of Bet, LTP yielded the proper insert with a low level of background through PCR:

AmiRNA-insert-diagnostic.jpg

Lanes: 1-7: Bet, corresponding to 65.55 degrees C for stitching Tm (even spacing)

Lanes: 8-10: LTP, corresponding to 65.55 degrees C during stitching annealing, even spacing

  • Digested
    • Bet,LTP inserts with X+P; B21 with X+P+phosphatase
  • Ligated, Transformed

08-06-2010 [ top ]

amiRNA

  • amiRNA-transformed turbo cells didn't grow in YEB medium. There should be more LB+Amp available by the end of the day. In the meantime, we're digesting some more backbone (8x20ul X+P+B21)
    • ligations of Bet/LTP into V0120

ihpRNA

  • no colonies on plates from transformations done yesterday after 16 hours (we let these plates grow for longer)
  • redoing ligations of ihpRNA inserts in V9/V10
    • Redigested and gel purified some backbone


  • Concentrations: V9 (5 ng/uL); V10 (6 ng/uL)
    • 12 ligations each for V9 and V10

08-09-2010 [ top ]

  • DTLs of amiRNA insert were unsuccessful. Yesterday we concluded this was because turbo cells + amp resistance don't grow on YEB media (we were out of LB+amp media). Today we must adopt a new hypothesis as 0/16 colonies grew on LB+amp media. Working theory is that the backbone digestions pictured below have the digested backbone and inserts as the two bands (top to bottom) instead of the undigested & digested backbone (in hindsight, I was trying to ligate into YFP*2, the original insert of B21). The confusion arose from the 1kb ladder, which at first appeared to match another ladder far better than 1kb (see Thursday's entry or thereabouts). This, combined with the fact that the 1kb ladder was hand-labeled, led me to suspect that it was in fact the other ladder (pR322 as pictured [http://openwetware.org/wiki/Image:Ladders.jpg here]). This, in turn, supported the (theorized incorrect) conclusion that the top & bottom bands [http://openwetware.org/wiki/Image:Bbcut1.jpg here] and [http://openwetware.org/wiki/Image:Bbcut2.jpg here] were undigested & digested backbone, respectively, and that the insert had diffused. I've DTL'd again, this time using the upper band (which didn't separate into digested & undigested bands after running for 30m on a .7% agarose gel) for ligation. We'll see on Monday how it went.
  • New Plan of action:
  1. Redigest V9/V10 (three digests of each backbone to use more DNA in ligations)
  2. Grew up V9/V10+ ihpRNA colonies
  3. Re pcrd amiRNA and digested to ligate into V9/V10
  4. Catalog parts to be ready for the registry

08-10-2010 [ top ]

ihpRNA

  • Only 2 colonies grew up (V10 9 (37c1) and V10 12 B(38 c2)) ger ihprna constructs
    • growing up colonies again in 5 mL cultures w/less antibiotic (50 ng/uL of kan)
    • concentrations: V10_9: 21.4 ng/uL V10_12B: 16.9 ng/uL
  • Diagnostic Digest (Should see ~ 7 kb band and 840 band)

Diagnostic Digest Ger ihpRNA into V10

  • Did not see exepcted bands (waiting on cultures grown up today to miniprep and hopefully transform into agrobacterium tommorow)

amiRNA

  • Ligated into V9/V10 and transformed

08-11-2010 [ top ]

  • Minipreps of (V95, V91, V99, V99b, V1011, V107B, V1012, V109b)
    • Concentrations (20-60 ng/uL range)
  • Diagnostic Digest (should see ~ 7 kb and 840 bp)

V910ddigestconfirm.jpg

Ladder, V9 5 (Bet2), V91(LTP), V99 (Ger), V99B (Ger), V1011 (Ger), V107b(Ger), V1012 (Ger), V109B (Ger)

V10 7B (Ger worked)

08-12-2010 [ top ]

ihpRNA

  • Minipreps of more V9/V10 colonies
  • Diagnostic Digest of minipreps w/ Eco and Pst (Should see ~840 and 7000 bp)

diagnostic digest of ihpRNA in agro vectors

ladder, V92, V92b, V94, V94b, V95, V96b, V97, V97b, V98, V98b

Lanes 2&3: LTP (11c1); Lanes 4&5: Bet2 (25c1); Lane 6: Bet2 (25c2); Lane 7: Bet2 (28c1); Lanes 8&9: Ger (36c1); Lanes 10&11 Ger (36c2)

  • Digested V9/V10 backbone for ligations w/ Eco & Pst (redoing ihpRNA ligations into V9/V10)

backbone

amiRNA

  • Ligated into V9/V10 and transformed (mutagenesis sites confirmed through pcr using 20 bp sepecific primers)
    • still need to be sequenced

08-13-2010 [ top ]

  • Organized parts so we could find them when we came back


<Note: remember to add more pics/less text>

Retrieved from "http://2010.igem.org/Team:Harvard/allergy/notebook"