Team:Aberdeen Scotland/Parts
From 2010.igem.org
University of Aberdeen - ayeSwitch
[http://partsregistry.org/Part:BBa_K385002 Part:BBa_K385002]: Phage MS2 coat protein
Length: 414 bp
Part type: coding
Part information
This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.
Sequence:
Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac
Design Notes
We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
Source [http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]
[http://partsregistry.org/Part:BBa_K385003 Part:BBa_K385003]: Phage lambda N-peptide
Length: 90 bp
Part type: coding
N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.
Sequence:
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac
Applications
The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.
Design Notes
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
Source Phage lambda genome
[http://partsregistry.org/Part:BBa_K385004 Part:BBa_K385004]: Phage lambda N-peptide
Length: 177 bp
Part type: coding
Sequence:
Applications
Design Notes
Source Phage lambda genome