Team:KAIST-Korea/Project/Introduction

From 2010.igem.org

Revision as of 11:27, 20 July 2010 by Imb10 (Talk | contribs)

 


Motivation

  There are many kinds of diseases that mankind is suffering. When we talk about this topic, we can think easily three issues which are malaria, HIV and tuberculosis. Malaria is a disease that is transmitted from human to human by mosquitoes. Each year, malaria causes nearly one million deaths and the majority of them occur in developing countries. And this disease is high-risk in children, pregnant women, travelers, refugees, displaced persons, and laborers entering endemic areas. In case HIV, there are 33 million people infected in the world and 95 percent of them are living in developing countries. At last, for tuberculosis, it caused by mycobacterium tuberculosis which affects lungs most. Until now, more than 2 billion people are infected with tuberculosis bacilli and 90 percent of them are in developing countries. As we can see, all of these diseases are very problematic in developing country.There are many kinds of diseases that mankind is suffering. When we talk about this topic, we can think easily three issues which are malaria, HIV and tuberculosis. Malaria is a disease that is transmitted from human to human by mosquitoes. Each year, malaria causes nearly one million deaths and the majority of them occur in developing countries. And this disease is high-risk in children, pregnant women, travelers, refugees, displaced persons, and laborers entering endemic areas. In case HIV, there are 33 million people infected in the world and 95 percent of them are living in developing countries. At last, for tuberculosis, it caused by mycobacterium tuberculosis which affects lungs most. Until now, more than 2 billion people are infected with tuberculosis bacilli and 90 percent of them are in developing countries. As we can see, all of these diseases are very problematic in developing country.

Estimated TB incidence rates.jpg
Fig 1. Estimated TB incidence rates, 2008


  In developing country, there are not much money and technology in medical development for testing and treating diseases. But unfortunately, basic medical tests like blood tests and biopsy and others need certain level of technical development. In addition, at some areas in developing countries doesn’t have electricity or access to high technology equipments. Therefore, we need new diagnosis system for disease test. For our system, we choose tuberculosis as a target. As the history goes on, technology related to diagnosis and treatment of tuberculosis has been developed. Especially for diagnosis, people do Tuberculin Skin Test, X-ray Test for its activation and examination of the sputum today. In addition, people take a blood test that involves ESR, white blood cell, CRP status checking. If necessary, CT and endoscopy can be added. Unfortunately, however, most of these tests require high technology and proper machines to process. Therefore, in developing countries these tests can be very hard to operate. As a solution, we think of a new idea for new diagnosis system.

Suffering.jpg
Fig 2. People suffering from malaria and TB                 Fig 3. Researching disease


  As the advanced version of diagnosis method, we suggest a system using antigen-antibody reaction. Actually, antibody can’t release signals by antigen-antibody reaction. So, we thought of fusion antibody-receptor as solution. Fusion antibody-receptor is a receptor which fused with other functional protein, antibody. In this way, we can get result by gene expression which would generally be GFP expression after our system is triggered by our target antigens. As a result, we can get possibility to make universal sensor by changing only target antigen’s antibody in fusion antibody-receptor. It should be very easy to diagnosis without heavy technology in the future.

Antibody.jpg
Fig 4. Antibody



Whole Pathway



Antibodies for Detecting Mycobacterium tuberculosis

  The major problem of Tuberculosis is including the prevalence of multi-drug-resistant strains and co-infection with human immunodeficiency virus. We found a report, and that is written that MPT51 is over-expressed on the tuberculosis cell membrane. So, we thought that we can use MPT51 as a antigen to detect tuberculosis. The reason why we selected these proteins is that they are differently over-expressed. Also, other normal human cell in our body does not have MPT51 protein on a cell. Therefore, if we can detect the existence of MPT51 on a cell, we could know that someone has tuberculosis or not. So, we will make fusion antibody that can cognize MPT51 as an antigen, and put it into yeast.

MPT51.jpg
Fig. 5 The crystal structure of Mycobacterium tuberculosis MPT51



Making Biosensor – Yeast Detector

Biosensor

  A biosensor is a device for the detection of an analyst that combines a biological component with a physicochemical detector component.[1] In order to make biosensor with genetically engineered organism, we should consider the following basic sensing process.

Receive input -> Process -> Extract output

  The ‘Receive input’ part can be alternated by represented receptor, the ‘Process’ part can be signaling pathway which changes input to output, and the ‘Extract output’ part can be something easily detectable by human. Nowadays, pigments or fluorescence proteins are usually used for output, and in order to express these substances, gene expression is made constant use in genetically modified organism. Thus, all engineered biosensors with organisms should be modeled on (consist of) 1) biochemical receptors which can activate gene expression, 2) biological pathway, and 3) gene activation for output.

Biosensor Processing




Organism Decision : Why Yeast?

  Why we use ‘Yeast’ instead of ‘E. coli’? E. coli control is easier than Yeast control. E. coli has faster cell cycle than Yeast. Moreover, there are many E. coli templates. But, although E. coli has many profits, we choose Yeast. Why? The following table is E. coli properties.[2]

E.coli general statistics.jpg


  According to the table, we can find easily some reasons that E. coli cannot work human pathway well.

  First, the periplasm’s thickness of E. coli is the very small as 10nm. In our project, we have to use human proteins. Almost human proteins are much bigger than E. coli’s proteins. (They are over 10nm*10nm*10nm.) Furthermore, in our project, FGFR has 20nm height. Therefore, this protein cannot be in periplasm, and our pathway cannot work completely.[3]

  Second, the average E. coli protein has only 360 residues, 5nm diameter, and 40kD MW. As we mentioned, our project’s proteins have over 1000residues, 10nm diameter and 50kD MW. Thus, the possibility that E. coli have our pathway is very low.

  However, Yeast has big volume size from 3~4 µm to 40 µm. [4] And Yeast is a eukaryotic, so it is more similar to human cell than E. coli. There is no physical problem of using human protein in yeast. And has more possibility to do our pathway. Therefore, we use Yeast instead of E. coli.


Organism Decision : Minimal genome fission yeast, Schizosaccharomyces pombe

  
Porting of cell signal transduction pathway is not easy for wild type organism. Most important reason is unwanted protein degradation. For wild type organism, unfamiliar protein can be harmful because it may be fragmented or misfolded proteins which disturb cellular pathway or viral proteins which may infect organisms. So wild type organism degrade unfamiliar proteins whether it is really harmful or not. And even degradation of at least one element of signal transduction pathway can disconnect whole pathway. So for successful porting of cell signal transduction pathway, inhibition of protease is important. Another problem is signal confusion. Basically, cellular signal transduction pathway is based on the protein-protein interaction(PPI). So unwanted PPI with elements of ported signal transduction pathway can confuse the signal. Of course if origin species of ported pathway is far enough from target species, we can exclude predictable unwanted PPI to avoid homologous proteins. But there are many unpredictable PPIs which can confuse the pathway. To avoid this problems, deletion of unnecessary proteins is required. And fission with minimal genome is made[5]. This yeast have only 1033 necessary genes of 5776 genes from wild type. So it may be useful to port cell signal transduction pathway from other organism(Human) without unwanted protein degradation or signal confusion.

Pombe.png
Fig 6. Schizosaccharomyces pombe homologus recombinant



  Schizosaccharomyces pombe (S. pombe) Deletion Mutant Library Sets were created by Dr. Kwang-Lae Hoe at KRIBB (Korea Research Institute of Biotechnology and Bioscience, Korea) through collaboration with Sir Paul Nurse at CRC (Cancer Research Center, UK, currently at the Rockefeller University in USA) and Bioneer based on the genome sequences of the S. pombe provided by the Wellcome Trust Sanger Institute. This genome-wide S. pombe deletion collection covers more than 98% of genome consisting of 4,914 genes. As each deletion strain has its distinct tags, functional analysis can be performed both in a gene-specific manner and a genome-wide scale. Two different sets of mutant collections are available: h+ haploids and h+/ h+ diploids.


Biochemical Receptors Selection


Biochemical Receptors


  The upper table represents classification of all biological receptors. First of all, since our genetically engineered machine has to detect on mycobacteria directly, we should select cell surface receptors. Next, we should consider using fusion-antibody-receptors. We used gene combination simply (add antibody to biological receptor without original receipt part). If the receptor has conformational change property when it accepts input signal, we guess that our fusion antibody receptor cannot operate well because antibodies characteristics (antigen size, antibody size, etc.) are different. They don’t have special receipt part in a whole receptor, of course, so whole receptor is important receipt part; we cannot create fusion-antibody-receptor with this protein anyway. Therefore, we choose ‘Dimerization’ receptor. Most of these receptors have Immunoglobulin-like receptor part which can be alternated by antibodies easily. Also, since biosensors should activate gene expression, we selected gene-regulation related receptors.

   Finally we choose cytokine receptors and receptor tyrosine kinases. Among them, Fibroblast Growth Factor Receptor (FGFR) in receptor tyrosine kinases was selected.

FGFR1.jpg
Fig 7. Crystal structure of a ternary FGF-FGFR-heparin complex



Fusion Antibody Receptor Making

  The Fusion Antibody-Receptor is a protein which receptor genetically combines with a specific antibody. The following figures show what the fusion antibody-receptor is for details.

Fusion antibody receptor.jpg


  The fusion antibody-receptor is designed by simple gene modification. We altered the Mycobacterium tuberculosis antigen detectable antibody single chain instead of the FGFR receptor’s antigen acceptable part (Immunoglobulin-like parts). Light chain part of the antibody – Linker – Heavy chain part of antibody is enough. (There are some evidences to success making fusion antibody-receptor with this method in some experiments. [4]) Then in order to express the receptor on cell surface membrane of Schizosaccharomyces pombe, we change the original signal peptide to outer membrane signal peptide of Schizosaccharomyces pombe. Surely the receptor should satisfy our standard for biosensor.


Signal peptide.jpg

  Schizosaccharomyces pombe Signal peptide from Cell wall integrity and stress response component 1

  Protein sequence:
  MVFLNSSPFKGRLLFFVYLLIISTRLVAA

  mRNA sequece:
  atggtgtttctgaacagcagcccgtttaaaggccgcctgctgttttttgtgtatctgctgattattagcacccgcctggtggcggcg


Signaling Pathway Research

  There are many signal pathways from plasma membrane receptor to the gene regulation. Here is an famous example of these pathways, MAP kinase pathway linked with RAS pathway. In this pathway,

  1. With existence of signal molecule, receptor kinases dimerize themselves and phosphorylate each other.
  2. This phosphorylated receptor dimer is cognized by Grb2 and recruit SOS protein, the Guanine nucleotide Exchange Factor(GEP)
  3. Recruited SOS protein substitute as GDP of Ras protein with GTP.
  4. Ras protein with GTP changes its conformation and activate its own kinase activity(Ras pathway so far)
  5. Ras kinase activate the MAP kinase kinase kinase, MAP KKK(also called as Raf protein) with phosphorylation
  6. MAP KKK activates the MAP kinase kinase, MAP KK(also called as Mek) with phosphorylation
  7. MAP KK activates the MAP kinase, MAP K(also called as Erk) with phosphorylation
  8. Activated MAP Kinase phosphorylates many cytosol proteins.
  9. For example, if Jun TF is phosphorylated by MAP K, phosphorylated Jun go inside of nucleus and activate the transcription to bind to DNA. (MAP pathway so far)


  But to port this signal pathway into the Yeast is not easy because this pathway is related with too many new proteins, so we should have found the simplest pathway. The followings are our history of the change in pathways. You can see the details 'Memo-etc page' in our wiki

  (1) Interleukin-1 pathways (8 proteins are required.)
  (2) Interleukin-6 JAK-STAT pathways (6 proteins are required.)
  (3) Fc Epsilon pathways (5 proteins are required.)
  (4) FGFR AP-1 pathways (4 proteins are required.)
  (5) FGFR STAT1 pathways (3 proteins are required.)


  Finally, we selected FGF signaling pathway which is the easiest way. The signal transduction step of FGF signaling pathway pathway as follows.


Signaling Pathway Research : Fibroblast Growth Factor Signaling Pathway

FGFR STAT1 pathway.jpg
Fig.8 FGF signaling pathway


  This figure show simple pathway of FGF(Fibroblast Growth Factor) and FGFR(Fibroblast Growth Factor). FGF is a growth factor concerned with wound healing and embryonic development.

FGFR STAT1 pathway2.jpg


  1. FGF binds to FGFR.(Syndecan-2 help in this process)
  2. STAT1 sticks to phosphorylating FGFR and then it gets phosphoryl group from FGFR(Phosphorylation)
  3. Two phosphorylating STAT1s attach each other and form dimer
  4. Dimer gets into nucleus and binds to GAS promoter
  5. Gene behind GAS promoter expresses.


Syndecan2 function.jpg
Fig.9 Unneccesary Syndecan-2 Function


  We applied this pathway to our project. Actually, Syndecan is a cell surface proteoglycan. Its core protein spans the plasma membrane and contains therr heparan sulfate chains and two chondroitin sulfate chains (not shown). The proteoglycans can codulate the activity of fibroblast growth factor (FGF). Free FGF binds poorly to the FGF receptor. Binding of FGF to the heparan sulfate chains like those on syndican allows FGF to bind efficiently its receptor. Binding of FGFto heparan sulfate in the ECM protects FGF and forms a reservoir of the growth factor. In addition we use antibody to detect tubercolusis antigen and GFP to confirm whether antigen is binded or not. Therefore, we don’t need Syndecan-2 because there is no FGF particle in this project.
  Finally, we become to need only 3 genes (Fusion FGFR, STAT1, GFP with GAS promoter) in our project

Design Gene Activation For Output


  STAT1 proteins with the formation of STAT1/1 dimers are confirmed using probe, namely the GAS probe. GAS probe(Gamma Activation Site probe) is the acute phase responsive element of the IL gene promoter and known to bind STAT1 dimer proteins. Using this pathway, we altered the green fluorescent protein (GFP) gene instead of cytokine inducible genes. So, we could show GFP expression through the previous whole pathway.[Fig. 5]

Figure. 5



References

Fig 1. Estimated TB incidence rates, 2008 WHO Library Cataloguing-in-Publication Data,
Global tuberculosis control: a short update to the 2009 report
Fig 2. People suffering from malaria and TB
Mother nature network, article “New form of malaria threatens Thai-Cambodia border”
Fig 3. Researching disease
Fondation Merieux Research Programs
http://www.fondation-merieux.org/-research-programmes.html
Fig 4. Antibody
Cytomx http://cytomx.com/technologies.html
Fig 5. MPT51
RCSB Protein Database, "The crystal structure of Mycobacterium tuberculosis MPT51"
Fig 6. Yeast homologous recombinant
Bioneer http://pombe.bioneer.co.kr/technic_infomation/construction.jsp
Fig 7. CRYSTAL STRUCTURE OF A TERNARY FGF2-FGFR1-HEPARIN COMPLEX
RCSB Protein Database, "CRYSTAL STRUCTURE OF A TERNARY FGF2-FGFR1-HEPARIN COMPLEX"
Fig 8. FGF signaling pathway
Nature Pathway Interation Database, "FGF signaling pathway"
http://pid.nci.nih.gov/search/pathway_landing.shtml?pathway_id=fgf_pathway&source=NCI-Nature%20curated&what=graphic&jpg=on&ppage=1
Fig 9. Unneccesary Syndecan-2 Function
http://www.kaomp.org/new/board_view.htm?table_name=photo_0&currPage=6&aq_id=92&aq_type=&aq_value
Fig 10.
Fig 11. Roberto, Proteína fluorescente verde – história e perspectivas, Química de Produtos Naturais (2009)


[1] International Union of Pure and Applied Chemistry. "biosensor". Compendium of Chemical Terminology :: Internet edition.
[2] Garrett, R.H., and Grisham, C.M. Biochemistry, 2nd Edition (2002), pg. 32
[3] RCSB PDB(protein database), http://www.rcsb.org/
[4] Walker K, Skelton H, Smith K. (2002). accessdate=2009-11-28 "Cutaneous lesions showing giant yeast forms of Blastomyces dermatitidis". Journal of Cutaneous Pathology 29 (10): 616–18. doi:10.1034/j.1600-0560.2002.291009.x