Team:Stockholm/24 August 2010

From 2010.igem.org

Revision as of 11:00, 26 October 2010 by Hassanforoughiasl (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Nina

Tranformation of protein A

I transformed 100 ul BL21 cells with both 1 and 3 ul of protein A inserted into the peX vector. This transformation is carried out in order to perform an IPTG induction on protein A in BL21 e.coli cells.

The transformation procedure is described in protocols. However, in step 1 I thawed the cells in 15 min instead of 10 min. In step 2 I added 1 ul of DNA sample to 100 ul BL21 cells and 3 ul of DNA sample to an additional 100 ul BL21 cells.

Sequencing of tyrosinase

Since the last sequencing of the two tyrosinase samples did not turn out well, I send two new tyrosinase samples for sequencing. This time I mixed the sample with primers complementary to the bank vector iGEM send the gene in. I therefore mixed with the primer VR. I choose VR instead of VF2 because I wanted the primer to bind closer to the site where I performed a site directed mutagenesis.

I prepared two tubes of tyrosinase:

15 ul plasmid from a mini-prep and 1.5 ul (10uM) primer VR of the vectors verification primers.

Colony #4: ASB0045 B01

Colony #6: ASB0045 B02

PCR on N_CPP cluster

We obtained our N_CPP in a lysophilized form in an eppendorf tube, to which I added 24 ul of dH2O, vortexed and spann down by centrifuging ~10 seconds.

I prepared a PCR mix with the N_CPP cluster as the DNA template. This PCR product will in following days become digested and ligated into both the pEX and shipping vector.

PCR mix:

Buffer Pfu buffer + MgSO4 10X 4.33 ul
dNTP 10 uM 1 ul
primer VF2 10 uM 3 ul
primer pgex 10 uM 3 ul
polymerase Pfu 1 ul
DNA template 1 ul
H2O 30 ul

I did a 1:5 dilution of primer pgex from 50 uM to 10 uM. 1 ul 50 uM primer and 4 ul dH2O.

PCR prgm:

Andreas

Glycerol stocks

From 23/8 ON cultures

1600 μl 100 % glycerol + 400 μl cell culture.

pEX vector 24/8
pSB1K3.SOD⋅His 1
pSB1K3.SOD⋅His 2

New cultures of the pSB1K3.yCCS⋅His will be set, as the current ones did not grow.

Assembly of SOD/yCCS⋅His into pSB1K3

Transformation results

From 23/8 transformations

pSB1K3.His⋅SOD: Good colony yield
pSB1K3.His⋅yCCS: Good colony yield

Colony PCR

Picked four colonies from each plate for colony PCR, as follows:

pSB1K3.His⋅SOD: HS1, HS2, HS3, HS4
pSB1K3.His⋅yCCS: Hy1, Hy2, Hy3, Hy4
Positive control: PC (pSB1K3.RFP plasmid)

Procedures according to colony PCR protocol.

Elongation time: 1:40

Gel verification

Gel verification of pSB1K3.His⋅SOD and pSB1K3.His⋅yCCS clones.
Loading volumes: 4 μl λ; 4 μl sample.
λ = O'GeneRuler 1 kb DNA ladder.

1 % agarose, 100 V, 1 h

Expected bands

pSB1K3.His⋅SOD: 815 bp
pSB1K3.His⋅yCCS: 1100 bp
Positive control: 1385 bp

Results

His⋅SOD: Well corresponding bands for samples HS1, HS3 and HS4, with HS1 possibly being slightly larger than the other two. This could also be an artifact from the gel.
His⋅yCCS: Well corresponding bands for samples Hy1 and Hy2.

ON cultures

Clones HS1, HS3, Hy1 and Hy2 were selected for verification by sequencing. ON cultures were set for plasmid and glycerol stock prep:

Plasmid prep
- 5 ml LB + 50 Km
- 37 °C, 250 rpm
Glycerol stocks
- 3 ml LB + 50 Km.
- 30 °C

MITF BioBrick construction

New MITF primers

MITF primers

>pRc/CMV_VF (24 bp)
AATACGACTCACTATAGGGAGACC

>pRc/CMV_VR (20 bp)
CGTTACTAGTGGATCCGAGC

>MITF_F_18aug (32 bp)
CTGGAAATGCTAGAATATAATCACTATCAGGT

>MITF_R_18aug (20 bp)
ACAAGTGTGCTCCGTCTCTT

>MITF_FB-F_18aug (64 bp)
GAAGAATTCGCGGCCGCTTCTAGATGGCCGGC
CTGGAAATGCTAGAATATAATCACTATCAGGT

>MITF_FB-R_18aug (53 bp)
GAACTGCAGCGGCCGCTACTAGTATTAACCGG
TACAAGTGTGCTCCGTCTCTT

New primers for MITF and pRc/CMV vector arrived.

pRc/CMV verification primers
- pRc/CMV_VF
- pRc/CMV_VR
MITF amplification primers
- MITF_F_18aug
- MITF_R_18aug
MITF amplification primers with 5' prefix/suffix primer extensions
- MITF_FB-F_18aug
- MITF_FB-R_18aug

PCR amplification

Ran PCR reactions using the three primer pairs and pRc/CMV.MITF plasmid DNA:

MITF VF (pRC/CMV verification primers)
MITF FR (MITF amplification primers)
MITF FB (MITF BioBrick primers)

PCR tubes (25 μl total volume)

illustra Ready-to-Go PCR tubes
Forward primer: 1 μl
Reverse primer: 1 μl
pRc/CMV MITF plasmid DNA (95 ng/μl): 0.5 μl
dH₂O: 22.5 μl

pRC/CMV verification

PCR program

MITF FB PCR program
1)	95 °C - 10:00
2)	95 °C - 00:30	x5
3)	55 °C - 00:30
4)	72 °C - 01:40
5)	95 °C - 00:30	x25
6)	72 °C - 00:30
7)	72 °C - 01:40
8)	72 °C - 10:00

MITF VF: Same as colony PCR settings above.
MITF VR: Same as colony PCR settings above.
MITF FB: See table to the right.

Gel verification

Gel verification of PCR amplified MITF with three different primer pairs
Loading volume: 4 μl λ; 4 μl sample
λ = O'GeneRuler 1 kb DNA ladder.

1 % agarose, 100 V, 45 min

Expected bands

MITF VF: ?
MITF FR: 1254 bp
MITF FB: 1313 bp

Results

Bands for both MITF FR and MITF FB correspond to expected fragment sizes, indicating successful MITF amplification! No band for MITF VF, but if the MITF FB band is correct, the pRc/CMV verification primers are not needed.

Transfer of MITF to pSB1C3

Digestion

Digested pSB1C3 vector (w/ RFP insert) as well as amplified MITF DNA with EcoRI and PstI.

[pSB1C3.RFP] = 201 ng/μl

Digestion tubes
[μl]	pSB1C3	MITF
10X FD buffer	3	3
DNA	10 (2 μg)	10
dH₂O	15	10
FD EcoRI	1	1
FD PstI	1	1

Incubation: 37 °C, 10 min
Enzyme inactivation: 80 °C, 5 min

Ligation

Ligation tube
Vector DNA (pSB1C3)	1.5 μl
PCR DNA (MITF)	10 μl
dH₂O	3.5 μl
5X Rapid Ligation buf.	4 μl
T4 DNA Ligase	1 μl
	20 μl

Incubation: 22 °C, 10 min

Quick transformation

Procedures according to protocol

1.5 μl ligation mix
Cm 25 LB agar plates