Team:Aberdeen Scotland/Parts

[http://partsregistry.org/Part:BBa_K385002 Part:BBa_K385002]: Phage MS2 coat protein

Length: 414 bp

Part type: coding

Part information

This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.

Sequence

Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac

Design Notes

We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)

Source [http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]

[http://partsregistry.org/Part:BBa_K385003 Part:BBa_K385003]: Phage lambda N-peptide

Length: 90 bp

Part type: coding

Part information

N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.

Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac

Applications

The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.

Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)

Source Phage lambda genome

[http://partsregistry.org/Part:BBa_K385004 Part:BBa_K385004]: Phage lambda N-peptide, tandem repeat

Length: 177 bp

Part type: coding

Part information

Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa K385004 confirmed sequence]

Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat

Applications

The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415. The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1).

A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence. Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.

Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)

Source Phage lambda genome

[http://partsregistry.org/Part:BBa_K385005 Part:BBa_K385005]: name

Length: bp

Part type:

Part information

Sequence

Applications

Design Notes

Source Phage lambda genome