Team:Yale/Our Project/Notebook/Week 8

• home
• our project
• our team

our project

• introduction
• applications
• methods
• lab notebook
• week 1
• week 2
• week 3
• week 4
• week 5
• week 6
• week 7
• week 8
• week 9
• protocols
• safety
• future work

lab notebook: week 8 (7/26-8/1)

• Monday 7/26--Efforts to confirm that ligation of phsABC and B0015 actually occurred.
See more/less

Miniprep & sequencing samples of likely ligation sucesses

• Miniprepped the overnight cultures from colonies 5, 12, 14, 15, 20, 21, and 24 according to the vacuum manifold protocol and nanodropped a few to find a ballpark concentration as around 200 ng/uL for each sample.
• Based on approximate concentration of miniprepped samples, prepared forward and reverse sequencing reactions for each. Each sequencing reaction mixture had 1.5 uL of the miniprepped DNA, 14.5 uL of water, and 2 uL of the primer, VF2 or VR depending on whether it was a forward or reverse reaction.

This day's work is also recorded on pages 81-82 of the lab notebook hard copy.
• Tuesday 7/27--Diagnostic double digest of likely ligations
See more/less

Diagnostic Double Digest of Supposed Ligations

• While waiting for sequencing data, will digest the miniprepped plasmids of the believed ligation successes with XbaI and SpeI and look to size of resulting fragments as evidence of ligation success.
• Ran a digestion of each of the likely ligated plasmids with the following components: 2 uL of NEB 4 buffer, 0.2 uL BSa, 0.7 uL SpeI, 0.7 uL XbaI, 2 uL plasmid DNA, and 14.4 uL of water. Let reaction run for 2 hours at 37˚C followed by a twenty minute heat-kill at 80˚C. Ran on an agarose 1.0% gel at 15 V while out of the lab, but found upon returning that too much of the buffer had evaporated, leading the gel to run extremely crookedly and making it useless.

This day's work is also recorded on page 83 of the lab notebook hard copy.
• Wednesday 7/28--Sequencing confirms ligation success!
See more/less

Sequencing success at last!

• Reran the double digest of 7/27, but repeating the gel was made unnecessary by the arrival of sequencing data confirming the successful ligation of phsABC into B0015.
See/hide sequence data
>sequence of desired phsABC/B0015 construct (minus background)
gaggaggtttattactagatgagcattagtcgtcgttcttttttgcagggggtaggcatcggctgctctgcctgcgcgctgggcgcttttccgcccgggg cgctggcgcgcaacccgattgccggcattaacggtaaaaccacgctaacgccaagcttgtgcgaaatgtgttcctttcgttgccctattcaggcgcaggt agtcaataacaagaccgtttttatccagggcaatccttctgcgccgcagcaggggacgcgcatatgcgccaggggcgggagcggcgtcagcctggtcaat gacccgcaacggattgtaaaacctatgaaacgcaccgggccacgcggcgacggtgaatggcaggtgattagctggcaacaggcttaccaggaaatcgcgg cgaaaatgaatgccatcaaagcgcagcatggccccgagagcgtggctttctcttccaaatcgggctcgctctccagccatcttttccatctggctacggc ctttggttcgcctaatacctttacgcacgcctcaacatgccctgccgggaaagccattgcggcaaaagtgatgatgggcggcgatctggcgatggatatc gctaacacgcgctatctggtttcgtttggccacaatttgtatgaagggattgaagttgccgatacccatgagttaatgaccgcgcaggagaagggggcca aaatggtgagcttcgatccgcgtttgtcgatattttccagcaaggcggatgagtggcacgctattcgtcccgggggggatttagcggttctgctggcgat gtgccacgtcatgattgatgaacagctctacgatgcgtcttttgttgagcgttataccagcggatttgaacagttagcacaggcggtaaaagagacgacg ccggaatgggccgccgcgcaggccgatgtcccagccgacgttattgtccgggtgacacgcgaactggctgcctgcgcgcctcacgctattgtcagtcctg gtcatcgcgcgacgttctcgcaggaagagatcgatatgcggcgtatgatttttacgcttaatgtgctgctcggtaatattgagcgcgaaggcgggctata tcagaaaaaaaacgcgtctgtttacaataaactggccggagaaaaggtcgcgccaacgctggcgaaactcaacattaaaaatatgccgaaaccgacggcg caacgcatcgatttggtcgcaccgcagtttaaatatatcgccgctggcggcggcgtggtgcaaagcattattgactcggcgttaacccagaagccttacc cgataaaggcgtggattatgtcgcggcataatcctttccagaccgtcacctgtcgttcggacctggtaaaaaccgttgagcaactggatctggtggtcag ctgcgatgtctatttgagcgagagcgcggcatatgccgactatctgctgccggaatgcacctatctcgaacgggacgaagaggtatccgatatgtcggga ctgcacccggcttacgctctgcgccaacaggtcgtagagccgattggcgaggcgcgtccgagttggcaaatctggaaagaacttggcgagcagttgggat tagggcagtactatccgtggcaggatatgcagacgcgccaactctatcagttgaacggcgaccatgccttagcgaaggaactgcgacagaaagggtatct cgaatggggcgttccgctgctattacgcgaaccagaatccgttcgtcagtttacggcgcgttaccccggcgctatcgcgacggacagtgacaacacctat ggcgaacagcttcgcttcaaatcgccctccggcaaaatcgaactttattccgcaaccctggaggaattgctccctggctacggcgttccgcgcgttcgtg actttgcgctgaaaaaagagaatgagctttacttcattcagggcaaggtggccgtgcataccaatggcgcgacgcagtacgtacctttactcagcgagct aatgtgggataacgcggtctgggttcatccgcaaacggcgcaagaaaaaggcattaagaccggcgatgagatctggctggaaaatgccacgggtaaagag aaaggtaaggcgctggtgacgcccggtatccgcccggacacgctttttgtctatatgggatttggcgctaaagctggggccaaaacggcggcgacgacac acggtatccactgcggaaatttactgccgcacgtgacgagtccggtatccggtacggtagtgcataccgcaggcgtgacgctgagccgggcatgaatgaa tcatttaacgaatcagtacgtcatgctgcatgatgaaaaacgttgtatcggctgccaggcgtgtaccgttgcctgcaaagtgcttaatgacgtaccggag ggatttagccgcgtacaggtacaaattcgcgcccctgaacaggcatccaacgcactaacccattttcaatttgtccgcgtctcctgtcagcactgtgaaa atgcgccatgtgtcagcgtttgtcctaccggagcgtcatatcgtgatgaaaacgggatcgtgcaggtggataaatcgcgctgtattggctgcgattattg tgttgccgcgtgtcctttccatgtgcgctatttgaatccgcaaaccggtgtcgccgacaagtgtaacttctgcgccgacacgcggttggcggctggccag tctccggcgtgcgtatccgtttgcccaacggacgcgctgaaattcggcagactggatgagagcgagatccagcgctgggtcggtcagaaagaggtctatc gccagcaggaggcgcgtagcggcgcggtcagtctgtaccgtcgtaaagaagtccatcaggagggtaaagcatgaatgaatactatctggggagcggaact acattatgcgccagattattggccgctgtggttaatttacgcaggcgtcgtggtgctgctcatgcttgttgggctggttatccatgcgttattgcgccgg atgctggcgccaaaaacggcgggcggtgaagaacatcgtgactatctctactcgctggcgattcgccgctggcattggggaaatgcgttactgtttgttt tattactgttaagcggtttatttggtcatttttctctcggccctgtagcgctaatggtacaagtgcatacctggtgtggttttgccttactggctttctg ggtcgggtttgtgctgatcaacctcaccacaggtaacgggcgtcactatcgggtaaatttttccggactggtaacgcgctgcatacgccagacgcgtttt tacctttttggcattatgaaaggggaagcgcatccgttcgtggcaacagagcagaataagttcaatccactgcaacaactggcatatctggcgattatgt acgcgctggtaccgctgttaatcatcaccggtttgctgtgtctctatccgcaggttgcgggtctgggccctgtgatgctggtgctgcatatggcgcttgc tatcatcggcttactgtttatttgcgcgcatctctatctgtgtactcttggcgacacgccgggacaaattttccgtagcatggttgacggctatcatcgt catcgtaccgcgccgcgcggggataagtccgccgtctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtttt atctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

>Forward sequence of ligation sample
>Reverse sequence of ligation sample


Beginning of second ligation efforts

• With the phsABC insert finally in B0015, the next step is to insert the Q04121 promoter in front of phsABC. Begin with double digests of Q04121 and the phsABC/B0015 construct double digest
• Q04121 double digest: 6 uL of Q04121, 5 uL of EcoRI buffer, 1.8 uL of EcoRI, 1.8 uL of SpeI, 0.5 uL of 100x BSA, and 34.9 uL of water.
• phsABC/B0015 construct sequential digest: 5 uL of DNA, 5 uL of NEB buffer 4, 0.5 uL of BSA, 1.8 uL of XbaI, and 37.7 uL of water.
• Run both of the digests for six hours at 37˚C before heat-killing with 20 minutes at 80˚C, then add 0.5 uL 5 M NaCl and 1.8 uL of EcoRI to the vector and let it have a five hour digestion period at 37˚C followed by another heat-kill at 80˚C.

This day's work is also recorded on page 83 & 84 of the lab notebook hard copy.
• Thursday 7/29--First attempt at Q04121 ligation
See more/less

Ligation of Q04121 and phsABC/B0015 construct

• Given that the DNA concentration of the 5.8 kb Q04121 insert is 20 ng/uL and that of the 7.8 kb vector is 19.3 ng/uL, calculate that 2.15 uL of insert is stoichiometric equivalent of 3 uL of vector. Based on this set-up the following ligation reactions and let them run for 8 hours at 16˚C before a 20 minute heat-kill.
Control ligation 2 uL of ligase buffer, 1 uL T4 ligase, 3 uL of vector, and 14 uL of water.
2:1 Insert:vector ligation 2 uL of ligase buffer, 1 uL T4 ligase, 3 uL of vector, 4.3 uL insert, and 9.7 uL of water.
5:1 Insert:vector ligation 2 uL of ligase buffer, 1 uL T4 ligase, 3 uL of vector, 10.8 uL of insert, and 3.2 uL of water.

• After the ligations were heat-killed, transformed them into Top10 supercompetent cells using the standard transformation protocol and a pUC19 control. Plated on kanamycin plates and left in incubator overnight.

This day's work is also recorded on page 84 of the lab notebook hard copy.
• Friday 7/30--No colonies visible from 7/29 transformation, so returned plates to incubator.
• Saturday 7/31--Plates from ligation transformation showed growth.
See more/less

Second ligation transformants

• The pUC19 and control ligation plates both showed many colonies, but the 2:1 ligation showed even more, while the 5:1 ligation showed 18 large colonies.
This day's work is also recorded on page 85 of the lab notebook hard copy.