Team:DTU-Denmark/SPL
From 2010.igem.org
Home | The Team | The Project | Parts submitted | Results | Notebook | Blog |
|
Introduction to Synthetic Promoter LibrariesModulation of gene expression of i.e. cellular enzyme activities (Solem and Jensen 2002), as well as regulation of transcription are amongst some of the areas where SPLs are currently being used. SPL provides an alternative method for gene regulation compared to older methods, namely those of gene knockouts and strong over expression. These two methods are usually based upon apparent rate limiting steps within metabolic pathways (Jensen and Hammer 1998). The point of randomizing both areas is to obtain a promoter library that is not biased towards being strong. This is achieved by giving two bases within each of the consensus regions a 50% chance of being their original bases, ensuring that only 1/16 of all promoters will be strong. This is without taking into consideration the fraction of strong promoters obtainable from the randomized spacer sequences. SPL as a New BioBrick StandardStrategy for Integrating SPL into the BioBrick Assembly StandardThere are many different ways to integrate an SPL into the BioBrick Standard, and a lot of ideas were considered when creating this RFC. However, in the end a method was chosen based on the fact that it would be least time consuming for teams looking to use SPL, and at the same time, be easy to do. Instead of relying on ligations to successfully insert the SPL onto the BioBrick plasmid backbone, a Polymerase Chain Reaction (PCR) method was designed to not only amplify the backbone but also add the SPL onto the linear BioBrick plasmid backbone at a specific chosen site (see Figure 2). Since most teams will probably have to amplify their backbones during the course of a project, this method will only require a small amount of extra work. The design of the SPL leads to the possibility of illegal restriction sites being present within the randomized spacer sequence. If a given promoter is to be used in further ligations it is vital that the promoter is sequenced first to ensure that it does not contain any recognition sites for EcoRI, XbaI, SpeI or PstI. The presence of these recognition sites could lead to the promoter being cut in a future restriction digest Primer DesignA PCR MUST be used in order to add the SPL onto the BioBrick plasmid backbone. The following primers for amplification of BioBrick plasmid backbones were used as a starting point for the design of our SPL primers:
The primers were taken from Parts Registry. The restriction enzyme recognition sites are marked with the following colors: Blue – EcoRI, Green – XbaI, Red – SpeI, Turquoise – PstI. In order to amplify and add the SPL successfully, the following modifications have been made to both of the annealing primers, which SHOULD be used: I) Primer SPL Suffix-F: 5’-GTTTCTTCACTAGTAGCGGCCGCTGCAG-3’ For this primer, a tail with the standard seven extra bases has been added. For more information see http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication. Depending on which backbone needs to be amplified, one of the following SPL primers SHOULD be used: II) Primer SPL Prefix-R-01: 5’- GTTTCTTCCTCTAGAAGCGGCNNNNATWWTANNNNNNNNNNNNNNNNNTGTSAWNNNNNCGC GAATTCCAGAAATCATCCTTAGCG -3’ III) Primer SPL Prefix-R-02: 5’- GTTTCTTCCTCTAGAAGCGGCNNNNATWWTANNNNNNNNNNNNNNNNNTGTSAWNNNNNCGC GAATTCGAGTCACTAAGGGC -3’ These primers have the SPL sequence inserted between the EcoRI and XbaI sites. Furthermore, 14-18 nt have been added to the 3’ end of the primer to ensure that the primers’ annealing sequences are long enough. Appendix I contains a list showing which primer to use with regard to which backbone is chosen.
|