"
Team:ESBS-Strasbourg/Results/Biobricks
From 2010.igem.org
{|
|
Biobricks
|
Parts Submitted to Registry
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Phytochrome Interacting Factor-3 (PIF3) - BBa_K365000
Background: PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX. Conception: The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 (Lim & Voigt, 2009.)We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site. 
The plasmid containing the PIF3-sequence was provided by the laboratory of Stephan Kircherfrom the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used. Forward primer (5’->3’): 51 bp GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC Reverse primer (5’->3’): 51 bp ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)). Primers for Pfu-mutagenese: Forward primer (5’->3’) (24 bp) GCAAACTCTTCAAGAGCTAGAGAG Reverse primer (5’->3’) (24 bp) CTCTCTAGCTCTTGAAGAGTTTGC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Phytochrome Interacting Factor-6 (PIF6) - BBa_K365001
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Phytochrome B (aa 1-908) - BBa_K365002
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Phytochrome B (aa 1-642) - BBa_K365003
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
∆N-ClpX (aa 61-425) - BBa_K365004
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Linker (aa 20) - BBa_K365005
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
LAA tag - BBa_K365006
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
DAS tag - BBa_K365007
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Lambda tag - BBa_K365008
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
GFP (super fold) - BBa_K365009
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
PhyB642-(linker-∆NClpX)3 - BBa_K365010
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
PhyB908-(linker-∆NClpX)3 - BBa_K365011
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Full-length ClpX - BBa_K365012
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
∆NClpX-linker-∆NClpX-linker-∆NClpX - BBa_K365013
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
(linker-∆NClpX)3 - BBa_K365014
... |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
16
... |
