Team:TU Delft/Protocols

From 2010.igem.org

Revision as of 09:50, 22 October 2010 by Mvoges (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Protocols

Use of provided BioBricks

From the iGEM organization each team has received a distribution kit containing selected biobricks from the previous years. These biobricks are provided in three 384 well plates containing dried DNA with which competent cells can transformed.

The biobricks are supplied as the DNA in a plasmid with a certain antibiotic resistance, which is denoted by a letter in the plasmid name. All the possible antibiotic resistances that are used within the Biobrick standard are ampicillin (A), chloramphenicol (C), erythromycin (E), gentamycin (G), kanamycin (K), neomycin (N), nalidixic acid (Na), rifampicin (R), spectinomycin (S), streptomycin (St), tetracycline (T), trimethoprim (Tm) and zeocin (Z).

Before use, the dried DNA must be resuspended. This protocol is based on Part registry

Materials

BioBrick distribution plate
milliQ

Protocol:

Punch a hole with a pipette tip through the foil cover into the corresponding well of the desired BioBrick part
Add 10 μL of milliQ
Pipette up and down several times, let sit for a few minutes

Making competent cells

Materials:

bacterial culture
0.1 M MgCl2
0.1 M CaCl2
80% glycerol
microcentrifuge
spectrophotometer

Protocol:

Cultivate bacterial cells in 100 mL LB medium, 37 °C o/n (140 rpm)
Cultivate 50 mL further in 80 mL LB, ~ 2 hours at 37 °C with shaking (140 rpm) until OD601 = 0.4
Centrifuge at 4,500 rpm for 6 min at 4 °C
Resuspend the pellet in 80 mL ice-cold 0.1 M MgCl2
Centrifuge at 4,500 rpm for 6 min at 4 °C
Resuspend the pellet in 50 mL ice-cold 0.1 M CaCl2 (do not vortex, stir with Pasteur pipet, solution should look like milk)
Incubate 15 min on ice
Centrifuge at 4,500 rpm for 6 min at 4 °C
Resuspend the pellet in 40 mL 0.1 M CaCl2 (do not vortex, stir with Pasteur pipet)
Incubate 60 min on ice
Centrifuge at 4,500 rpm for 10 min at 4 °C
Add 1 à 2 mL ice-cold 80% glycerol (depends on the amount of pellet)
Divide in parties of 30 µL and quickly put them in the liquid nitrogen
Freeze in -80 °C

Transformation Home-Made competent cells

Materials:

competent cells
LB medium (warmed to room temperature)
Plasmid DNA or DNA ligation mix
LB agar plates containing 15-100 μg/mL antibiotic of choice, pre-warmed to 37 °C
water bath at 37 °C
shaking incubator at 37 °C.

Protocol:

Add 50-100 ng DNA into a 30 μL competent E.coli, and mix gently. Do not mix by pipetting up and down!
Incubate tube vial on ice for 15 minutes
Heat-shocks the cells for 5 minutes at 37 °C without shaking
Immediately transfer the tubes back to ice for 2 minutes
Add 800 μL of room temperature LB medium
Cap tube tightly and shake tube horizontally (225 rpm) at 37 °C for 1 hour
Spin tube (2,000 rpm, 2 minutes), discard supernatant to leave no more than 100 μL, vortex and plate on an agar plate containing antibiotic
Incubate plates overnight at 37 °C

Transformation commercial competent cells

Materials:

competent cells
SOC medium (warmed to room temperature)
Plasmid DNA or DNA ligation mix
LB agar plates containing 15-100 μg/mL antibiotic of choice, pre-warmed to 37 °C
water bath at 42 °C
shaking incubator at 37 °C.

Protocol:

Add 50-100 ng DNA into a 20 μL competent E.coli, and mix gently. Do not mix by pipetting up and down!
Incubate tube vial on ice for 30 minutes
Heat-shocks the cells for 30 seconds at 42 °C without shaking
Immediately transfer the tubes back to ice for 2 minutes
Add 250 μL of room temperature SOC medium
Cap tube tightly and shake tube horizontally (225 rpm) at 37 °C for 1 hour
Plate from each tube 100 μL on an agar plate containing antibiotic.
Incubate plates overnight at 37 °C

Transformation efficiency (CFU/µG)

For example, if 10 pg of pUC19 yield 50 colonies when 50 µL of a 1:100 dilution is plated, then:

Birnboim Plasmid Isolation

This plasmid isolation is used to obtain plasmid DNA that can be used to test the transformed colonies for the right insert.

Materials:

bacterial culture
milliQ
BB solution I (10 mg/mL glucose; 25 mM Tris-HCl pH 8,0; 10 mM EDTA, 0,1 mg/mL RNAse A)
BB solution II (0.2 NaOH; 1% SDS)
BB solution III (3 M NaAc, pH 4,8 = 100 mL: 40,8 g NaAc.3H2O, 38 mL HAc, 52 mL H2O)
BB solution IV (0.3 m NaAc)
cold 70% ethanol
cold 100% ethanol
microcentrifuge
nanodrop

Protocol:

Pour 1 mL overnight bacterial culture into Eppendorf tube, centrifuge for 1 minute at maximum speed (13,000 rpm). Carefully suck off supernatant
Resuspend the bacterial pellet in 100 μL cold solution I, suspend well (vortex) and incubate for 15 min on ice
Vortex shortly and add immediately 200 μL fresh solution II (make fresh, every two weeks, keep at room temperature), mix vigorously (no vortexing) and leave 1 minute at room temperature
Add 150 μL cold solution III, mix gently until white precipitate appears and incubate on ice for 30 minutes
Centrifuge at maximum speed for 5 minutes at room temperature (Eppendorf centrifuge)
Take 400 μL of the supernatant (beware of taking along some pellet) and add to 800 μL of cold (-20 °C) 100% ethanol
Mix, leave at -20 °C for 30 minutes and centrifuge at room temperature for 10 minutes maximum speed (Eppendorf centrifuge)
Carefully pipet off the supernatant
Add 100 μL solution IV, mix by vortexing and add 200 μL ice cold 100% ethanol. Incubate at -20 °C for 30 minutes. Centrifuge 10 minutes full speed (Eppendorf centrifuge), carefully discard supernatant (pipet)
Wash DNA pellet with 1 mL of ice cold 70% ethanol and centrifuge for 10 minutes maximum speed (Eppendorf centrifuge) can carefully pipet off the supernatant
Air-dry the pellet for 5 minutes, and redissolve the DNA in 50 μL water
Measure DNA concentration on the Nanodrop

QIAGEN Mini-prep plasmid isolation

This protocol is based on QIAGEN® Plasmid Purification Handbook.

This protocol is designed for preparation of up to 20 µg of high-copy plasmid or cosmid DNA using the Qiagen Plasmid Mini Kit. Qiagen plasmid isolation is used to obtain very pure plasmid DNA.

Maximum recommended culture volumes for the Qiagen-tip 20:

High-copy plasmids 1-5 mL

Materials:

bacterial culture
Qiagen colums
buffer P1 (100 μg/mL RNAse A, 50 mM Tris/HCl, 10 mM EDTA, pH 8.0)
buffer P2 (200 mM NaOH, 1% SDS)
buffer P3 (3 M KAc, pH 5.5)
buffer PE
milliQ pH 8.0
centrifuge
nanodrop

Protocol:

Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 2–5 mL LB medium containing the appropriate selective antibiotic. Incubate for approximately 8 h at 37°C with vigorous shaking (approx. 300 rpm)
Harvest the 5 mL bacterial cells by centrifugation at 13,000 rpm for 1 min at 20°C (microcentrifuge tube). If you wish to stop the protocol and continue later, freeze the cell pellets at –20°C
Resuspend pelleted bacterial cells in 250 μL Buffer P1. Ensure that RNase A has been added to Buffer P1. No cell clumps should be visible after resuspension of the pellet.
Add 250 μL Buffer P2 and mix thoroughly by inverting the tube 4–6 times. Mix gently by inverting the tube. Do not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the tube until the solution becomes viscous and slightly clear. Do not allow the lysis reaction to proceed for more than 5 minutes.
Add 350 μL Buffer N3 and mix immediately and thoroughly by inverting the tube 4–6 times. To avoid localized precipitation, mix the solution thoroughly, immediately after addition of Buffer N3. Large culture volumes (e.g. ≥5 mL) may require inverting up to 10 times. The solution should become cloudy.
Incubate at -20 °C for 15 minutes.
Centrifuge for 10 min at 13,000 rpm in a table-top microcentrifuge. A compact white pellet will form.
Apply the supernatants from step 7 to the QIAprep spin column by decanting or pipetting.
Centrifuge for 30–60 seconds. Discard the flow-through.
Wash QIAprep spin column by adding 0.75 mL Buffer PE and centrifuging for 30–60 seconds.
Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer. Important: Residual wash buffer will not be completely removed unless the flow-through is discarded before this additional centrifugation. Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions.
Place the QIAprep column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 30 μL Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of each QIAprep spin column, let stand for 1 minute, and centrifuge for 1 minute.
Measure DNA concentration on the Nanodrop

QIAGEN Midi-prep plasmid isolation

This protocol is based on QIAGEN® Plasmid Purification Handbook.

This protocol is designed for preparation of up to 100 µg of high- or low-copy plasmid or cosmid DNA using the Qiagen Plasmid Midi Kit. Qiagen plasmid isolation is used to obtain very pure plasmid DNA.

Maximum recommended culture volumes for the Qiagen-tip 100:

High-copy plasmids 25 mL

Low-copy plasmids 100 mL

Materials:

bacterial culture
Qiagen colums
buffer P1 (100 μg/mL RNAse A, 50 mM Tris/HCl, 10 mM EDTA, pH 8.0)
buffer P2 (200 mM NaOH, 1% SDS)
buffer P3 (3 M KAc, pH 5.5)
buffer QBT (750 mM NaCl, 50 mM MOPS, 15% Ethanol, pH 7.0, 0.15% Triton X-100)
buffer QC (1 M NaCl, 50 mM MOPS, 15% Ethanol, pH 7.0)
buffer QF (1.25 M NaCl, 50 mM Tris/HCl, 15% Ethanol, pH 8.5)
isopropanol
milliQ
centrifuge
nanodrop

Protocol:

Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 25 to 100 mL LB medium containing the appropriate selective antibiotic. Incubate for approximately 8 h at 37°C with vigorous shaking (approx. 300 rpm)
Harvest the 25 to 100 mL bacterial cells by centrifugation at 4,000 rpm for 15 min at 4°C ( Sorvall buckets). If you wish to stop the protocol and continue later, freeze the cell pellets at –20°C
Resuspend the bacterial pellet in 4 mL of chilled Buffer P1 (containing RNAse) and pour into a blue cap 50 mL tube
Add 4 mL of Buffer P2, mix gently but thoroughly by inverting 4–6 times, and incubate at room temperature for 5 minutes
Add 4 mL of chilled Buffer P3, mix gently by inverting 4–6 times, and incubate on ice for 15 minutes
Centrifuge 30 min at 4,000 rpm and pour supernatant through cheesecloth into a fresh blue cap 50 mL tube
During centrifugation equilibrate a Qiagen-tip 100 by applying 4 mL Buffer QBT, and allow the column to empty by gravity flow
Apply the supernatant from step 6 onto the Qiagen-tip and allow it to enter the resin by gravity flow
Wash the Qiagen-tip with 2 × 10 mL Buffer QC
Elute DNA with 5 mL Buffer QF into 15 mL blue cap tube
Precipitate DNA by adding 3.5 mL (0.7 volumes) room-temperature isopropanol to the eluted DNA
Mix and centrifuge immediately at 4,000 rpm for 30 minutes at 4 °C
Proceed immediately when centrifuge stops and carefully decant the supernatant
Wash DNA pellet with 2 mL of cold 70% ethanol, and centrifuge at 4,000 rpm for 10 minutes at 4 °C
Carefully decant the supernatant without disturbing the pellet
Air-dry the pellet for 5–10 min (has to be dry), and redissolve the DNA in a suitable volume of milliQ H2O
Measure DNA concentration on the Nanodrop

QIAGEN Maxi-prep plasmid isolation

This protocol is based on QIAGEN® Plasmid Purification Handbook.

This protocol is designed for preparation of up to 100 µg of high- or low-copy plasmid or cosmid DNA using the Qiagen Plasmid Midi Kit. Qiagen plasmid isolation is used to obtain very pure plasmid DNA.

Maximum recommended culture volumes for the Qiagen-tip 100:

High-copy plasmids 100 mL

Low-copy plasmids 500 mL

Materials:

bacterial culture
Qiagen colums
buffer P1 (100 μg/mL RNAse A, 50 mM Tris/HCl, 10 mM EDTA, pH 8.0)
buffer P2 (200 mM NaOH, 1% SDS)
buffer P3 (3 M KAc, pH 5.5)
buffer QBT (750 mM NaCl, 50 mM MOPS, 15% Ethanol, pH 7.0, 0.15% Triton X-100)
buffer QC (1 M NaCl, 50 mM MOPS, 15% Ethanol, pH 7.0)
buffer QF (1.25 M NaCl, 50 mM Tris/HCl, 15% Ethanol, pH 8.5)
isopropanol
milliQ
centrifuge
nanodrop

Protocol:

Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 100 to 500 mL LB medium containing the appropriate selective antibiotic. Incubate for approximately 8 h at 37°C with vigorous shaking (approx. 300 rpm)
Harvest the 100 to 500 mL bacterial cells by centrifugation at 4,000 rpm for 15 min at 4°C (Sorvall buckets). If you wish to stop the protocol and continue later, freeze the cell pellets at –20°C
Resuspend the bacterial pellet in 10 mL of chilled Buffer P1 (containing RNAse) and pour into a blue cap 50 mL tube
Add 10 mL of Buffer P2, mix gently but thoroughly by inverting 4–6 times, and incubate at room temperature for 5 minutes
Add 10 mL of chilled Buffer P3, mix gently by inverting 4–6 times, and incubate on ice for 20 minutes
Centrifuge 30 min at 4,000 rpm and pour supernatant through cheesecloth into a fresh blue cap 50 mL tube
During centrifugation equilibrate a Qiagen-tip 100 by applying 10 mL Buffer QBT, and allow the column to empty by gravity flow
Apply the supernatant from step 6 onto the Qiagen-tip and allow it to enter the resin by gravity flow
Wash the Qiagen-tip with 2 × 30 mL Buffer QC
Elute DNA with 15 mL Buffer QF into 50 mL blue cap tube
Precipitate DNA by adding 10.5 mL (0.7 volumes) room-temperature isopropanol to the eluted DNA
Mix and centrifuge immediately at 4,000 rpm for 30 minutes at 4 °C
Proceed immediately when centrifuge stops and carefully decant the supernatant
Wash DNA pellet with 5 mL of cold 70% ethanol, and centrifuge at 4,000 rpm for 10 minutes at 4 °C
Carefully decant the supernatant without disturbing the pellet
Air-dry the pellet for 5–10 min (has to be dry), and redissolve the DNA in a suitable volume of milliQ H2O
Measure DNA concentration on the Nanodrop

Freezing of bacterial stocks

Materials:

bacterial culture
LB medium
80% glycerol
centrifuge

Protocol:

Take 5 mL bacterial cells from the Erlenmeyer of a freshly grown culture and spin in a 15 mL tube for 10 minutes at 2,000 rpm (Eppendorf centrifuge)
Decant the supernatant without disturbing the pellet
Pipet on the pellet 0.5 mL 1% LB medium and 0.5 mL 80% glycerol and mix by vortexing and save in -80 °C freezer

Restriction enzyme digestion

Materials:

plasmid DNA or PCR product
restriction enzymes (Roche and BioLabs)
buffer (10x)
H2O
water bath at 37 °C
heat block or water bath at 65 °C

Protocol:

Digestions (cutting plasmid DNA) were performed at the appropriate temperature with the appropriate buffer in the appropriate concentration, according to the supplier.

Reaction for one sample:

DNA	x μL (up to 1,0 μg)
Buffer (10x)	x μL (for 1×)
Restriction enzymes	x μL (10 units/μg DNA = 1 µL)
H2O	x μL
	20-25 μL

Incubate for (at least) one hour at 37 °C. Inactivate the restriction endonucleases by heat, incubation at 80°C for 10 minutes and centrifuge shortly.

Used Buffers:

Buffer H (Roche): 50 mM Tris-HCl, 1 M NaCl, 100 mM MgCl2, 10 mM DTE, pH 7.5 at 37 °C

Buffer M (Roche): 100 mM Tris-HCl, 500 mM NaCI, 100 mM MgCl2, 10 mM DTE, pH 7.5 at 37 °C

Buffer 1 (BioLabs): 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl2, 1 mM DTE,pH 7.0 at 25°C

Buffer 2 (BioLabs): 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTE, pH 7.9 at 25°C

Buffer 3 (BioLabs): 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTE, pH 7.9 at 25°C

Buffer 4 (BioLabs): 50 mM CH3CO2K, 20 mM TAE, 10 mM Mg(CH3COO)2, 1 mM DTE, pH 7.9 at 25°C

Note: some of the restriction enzymes of New England BioLabs required the addition of 100 µg/mL BSA

Ligation

Materials:

digested plasmid DNA or PCR product
T4 ligation buffer (10x) (Fermentas)
T4 ligase (Fermentas)
H2O
water bath at 16 °C

Protocol:

Ligations (pasting plasmid DNA) were performed at the appropriate temperature with the appropriate buffer in the appropriate concentration, according to the supplier.

Reaction for one sample:

DNA insert	x μL
DNA vector	x μL
T4 Ligation buffer (10×)	x μL (for 1×)
T4 Ligase	1.0 μL
H2O	x μL
	10-15 μL

The final concentration is preferably ~100 ng/μL. Incubate at 16 °C for at least 3 hours. For transformation use circa half of the ligation mix.

Transform circa half of the ligation mix. Incubate at 16 °C o/n

Agarose gel

Materials:

agarose
TBE buffer
SYBRSafe (Invitrogen)

Protocol:

Dissolve 1 g of agarose in 100 mL 1x TBE buffer for 1% gel (can be stored in the 70 °C stove)
Add 5 µL of SYBRSafe

PCR

Materials:

Pfx polymerase (Invitrogen)
10x Pfx Buffer (Invitrogen)
enhancer (Invitrogen)
50 mM MgSO4 (Invitrogen)
10 mM dNTPs
primer solutions 5 mol/mL
template DNA (plasmid at 50 pg – 1 ng/μL)
PCR machine

Protocol:

First make sure that there is a PCR machine available for you. Take the solutions from the freezer and thaw them on ice. Preparation of reaction mixture:

Gently vortex and briefly centrifuge all solutions after thawing
Keep solutions on ice
Add to a thin walled PCR tube, on ice, for a 50 μL reaction:

1× pre-mix

Component	Sample
Pfx polymerse	0.6 μL
10x Pfx buffer	5 μL
Enhancer	5 μL
10 mM dNTPs	1.5 μL
50 mM MgSO4	1 μL
Primer 1	3 μL
Primer 2	3 μL
DNA template	1 μL
H20	29.9 μL

Gently vortex the sample and briefly centrifuge (5 sec) to collect all droplets at the bottom of the tube

PCR program:

Step	Annealing Temperature	Time, min:sec	Number of cycles
Initial denaturation	95 °C	2:00	1
Annealing	x °C *	1:00	1
Extension	68 °C	1:00-2:00	1
Denaturation	95 °C	1:00	25
Annealing	x °C *	1:00	25
Extension	68 °C	1:00-2:00	25
Final Extension	68 °C	10:00	1

* Annealing temperature dependent on primer. Optimal temperature: 3x G/C + 2x A/T

Overlapping PCR

Materials:

Pfx polymerase (Invitrogen)
10x Pfx Buffer (Invitrogen)
enhancer (Invitrogen)
50 mM MgSO4 (Invitrogen)
10 mM dNTPs
primer solutions 5 mol/mL
template DNA (plasmid at 50 pg – 1 ng/μL)
PCR machine

Protocol:

First make sure that there is a PCR machine available for you. Take the solutions from the freezer and thaw them on ice. Preparation of reaction mixture:

Gently vortex and briefly centrifuge all solutions after thawing
Keep solutions on ice
Add to a thin walled PCR tube, on ice, for PCR reaction:

1× pre-mix

Component	Sample
Pfx polymerse	0.6 μL
10x Pfx buffer	5 μL
Enhancer	5 μL
10 mM dNTPs	1.5 μL
50 mM MgSO4	1 μL
DNA template	1 μL
H20	29.9 μL

Gently vortex the sample and briefly centrifuge (5 sec) to collect all droplets at the bottom of the tube

PCR program:

Step	Annealing Temperature	Time, min:sec	Number of cycles
Initial denaturation	95 °C	2:00	1
Annealing	X °C*	1:00	1
Extension	68 °C	1:00	1
Denaturation	95 °C	1:00	5
Annealing	X °C *	1:00	5
Extension	68 °C	1:00	5
add primers (3 μL Primer 1 + 3 μL Primer 2)
Denaturation	95 °C	1:00	25
Annealing	X °C *	1:00	25
Extension	68 °C	1:00-2:00 (1min/kb)	25
Final Extension	68 °C	10:00	1

* Annealing temperature dependent on primer. Optimal temperature: 3x G/C + 2x A/T

Colony PCR

Materials:

Taq PCR Master Mix (Qiagen) is premixed solution containing Taq DNA Polymerase, PCR Buffer and dNTPs. The solution provides a final concentration of 1.5 mM MgCl2 and 200 μM each dNTP.
primer solutions 5 mol/mL
PCR machine

Protocol:

First make sure that there is a PCR machine available for you. Take the solutions from the freezer and thaw on ice. Preparation of reaction mixture:

Gently vortex and briefly centrifuge all solutions after thawing
Keep solutions on ice
Make a pre-mix for the amount of colonies (to be analyzed) + 1, add to an Eppendorf tube:

1× pre-mix

Component	Sample
Taq PCR Master Mix (Qiagen)	12.5 μL
Primer 1	1.5 μL
Primer 2	1.5 μL
H20	9.5 μL

Add 25 μL of pre-mix to each PCR tube.
Prick a sterile toothpick into a colony, dip it into a PCR tube, put it into a 15 mL culture tube containing 5 mL LB medium + antibiotics and then grow overnight for mini-prep cultures and -80 °C stocks. Repeat this for all the colonies. Incubate the mini-prep cultures at 37 °C.
Keep everything ice cold until you put the tubes in the preheated PCR machine

PCR program:

Step	Annealing Temperature	Time, min:sec	Number of cycles
Initial denaturation	94 °C	2:00	1
Denaturation	94 °C	1:00	30
Annealing	x °C *	0:45	30
Extension	72 °C	1:00	30
Final Extension	72 °C	5:00	1

* Annealing temperature dependent on primer. Optimal temperature: 3x G/C + 2x A/T

QIAGEN Gel Extraction

This protocol is based on QIAGEN® Gel Extraction Handbook.

Materials:

QIAquick columns
buffer QG
buffer PE
isopropanol
milliQ
microcentrifuge
heat block at 50 °C

Protocol:

Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μL). For >2% agarose gels, add 6 volumes of Buffer QG. The maximum amount of gel slice per QIAquick column is 400 mg; for gel slices >400 mg use more than one QIAquick column.
Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation. IMPORTANT: Solubilize agarose completely. For >2% gels, increase incubation time.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If the color of the mixture is orange or violet, add 10 μL of 3 M sodium acetate, pH 5.0, and mix. The color of the mixture will turn to yellow. The adsorption of DNA to the QIAquick membrane is efficient only at pH <7.5. Buffer QG contains a pH indicator which is yellow at pH <7.5 and orange or violet at higher pH, allowing easy determination of the optimal pH for DNA binding.
Add 1 gel volume of isopropanol to the sample and mix. This step increases the yield of DNA fragments <500 bp and >4 kb. For DNA fragments between 500 bp and 4 kb, addition of isopropanol has no effect on yield. Do not centrifuge the sample at this stage.
Place a QIAquick spin column in a provided 2 ml collection tube.
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min. The maximum volume of the column reservoir is 800 μL. For sample volumes of more than 800 μL, simply load and spin again.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 10,000 x g (~13,000 rpm). IMPORTANT: Residual ethanol from Buffer PE will not be completely removed unless the flow-through is discarded before this additional centrifugation.
Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μL of Buffer EB (10 mM Tris·Cl, pH 8.5) or H2O to the center of the QIAquick membrane and centrifuge the column for 1 min at maximum speed. Alternatively, for increased DNA concentration, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min. Important: Ensure that the elution buffer is dispensed directly onto the QIAquick membrane for complete elution of bound DNA. The average eluate volume is 48 μL from 50 μL elution buffer volume, and 28 μL from 30 μL. Elution efficiency is dependent on pH. The maximum elution efficiency is achieved between pH 7.0 and 8.5. When using water, make sure that the pH value is within this range, and store DNA at –20°C as DNA may degrade in the absence of a buffering agent. The purified DNA can also be eluted in TE (10 mM Tris·Cl, 1 mM EDTA, pH 8.0), but the EDTA may inhibit subsequent enzymatic reactions.

Precipitation of PCR products

Materials:

3 M sodium acetate pH 4.8
96% ethanol
70% cold ethanol
MilliQ
microcentrifuge
heat block at 37 °C
nanodrop

Protocol:

Add 1/10 volumes of 3 M sodium acetate pH 4.8 to the PCR mixture
Add 2 volumes 96% ethanol
Incubate 15 minutes at -80 °C or 30 minutes at -80 °C
Centrifuge at 14.000 rpm for 10-15 minutes at 4 °C
Proceed immediately when centrifuge stops and carefully decant the supernatant
Wash DNA pellet with 100 μL of ice cold 70% and centrifuge at 14.000 rpm for 10 minutes at 4 °C
Carefully decant the supernatant without disturbing the pellet
Air-dry the pellet and redissolve the DNA in water and incubate for 10 minutes at 37 °C
Measure DNA concentration on the Nanodrop

Protein Purification

Materials:

bacterial culture on plates
LB medium
25 mM TEA (triethanolamine buffer), pH 8.0
1% lysozyme in TEA
4 M Urea
10% streptomycin in TEA
25 mM Tris buffer, pH 8.0
glass beads
centrifuge
spectrophotometer

Protocol:

Cultivate bacterical cells on plates, 37 °C o/n (140 rpm)
Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 250 mL LB medium containing the appropriate selective antibiotic. Incubate at 37°C with vigorous shaking
Induce production of protein with 1 mM IPTG when OD600 is reached (check with 1.5 mL sample)
Harvest after 2 hours the 250 mL bacterial cells by centrifugation at 10.000 rpm for 10 min (Sorvall buckets)
Collect the free supernatant and store it
Wash pellet with TEA buffer, pH 8.0
Freeze pellet in -80 °C for 15 minutes
Resuspend pellet in 30 mL TEA with 1% lysozyme (final concentration 0.02%)
Incubate for 10 min at RT
Disrupt cells with glass beads and vortex for 10 minutes
Centrifuge at 14 .000 rpm for 30 min at 4°C (protein is in supernatant)
Aliquot 1.8 mL supernatant into fresh eppendorf tubes and add 200 μL 10% streptomycin in TEA (final concentration 1%).
Centrifuge supernatant 14 .000 rpm for 30 min at 4°C (protein is in pellet)
Resuspend pellet in 4 M Urea
Centrifuge supernatant 14.000 rpm for 30 min at 4°C (protein is in supernatant)
Dialyse supernatant from step 14 overnight 20 mM Tris buffer
Dialyse supernatant from step 5 overnight 20 mM Tris buffer

Protein content measurements (Bradford Assay)

Materials:

2 mg/mL BSA
bradford reagens
spectrophotometer

Protocol:

Make a dilution serie of standard 2 mg/mL bovine serum albumin (BSA). Use 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 μL
Add MillQ to a total volume of 800 μL
Add 200 μL Bradford reagens and mix
Measure after minimal 5 min and max 60 min the OD595

Emulsifier test

Materials:

25 mM Tris buffer, pH 8
emulsifier sample
0.1% Sudan II in 50% EtOH
shaking incubator at 30 °C
spectrophotometer

Protocol:

Determine protein concentration by Bradford assay
Aliquot 0.1-0.5 mL of protein sample in a cuvet
Add Tris buffer up to 1 mL
Add 20 μL 0.1% Sudan II
Vortex 15 seconds at max speed
Let sample rest for 1 minute
Measure absorbance at OD493
Dilute sample to get in the right absorbance range if neccesary

Preparing cell lysates for enzyme kinetics measurements

Materials:

bacterial culture on plates
LB medium
50 mM Tris buffer, pH 7.5 (or pH closer to optimal pH of enzyme to be studied)
100 mL glass flasks
Shaking incubator
Sonicator (Branson Sonifier 250)
Ice bucket
Greiner tube centrifuge

Protocol

Pick a single colony from a freshly streaked selective plate and inoculate a starter culture of 50 mL LB medium containing the appropriate selective antibiotic. Incubate at 37°C, 160 rpm.
Spin down the cultures at an OD of +/- 0.6 in 50 mL greiner tubes for 10 min at 4000 rpm using a chilled (4 degrees) centrifuge.
Resuspend the cells in 5 mL of 50 mM Tris buffer (with the appropriate pH) and keep on ice until sonication.
Sonicate the suspension (placing the tip as close as possible to the bottom of the tube, without touching) for 3 minutes at a 40% duty cycle and an output control of 4; all the while keeping the suspension on ice.
Spin down the suspension for 5 minutes @ 4000 rpm in a chilled centrifuge.
Your supernatant now contains your enzyme of interest. You can do protein determination assays.

Buffers and Stock solutions

Luria-bertani (LB)

For 1 liter dissolve in H2O:

Compound/Ingredient	Amount required (1L of medium)
Tryptone	10 g
Yeast extract	5 g
NaCl	10 g
Agar+	15 g

+ Add agar in case a solid medium is required.

Autoclave on a liquid cycle. Once broth reaches room temperature, store in cold room.

M9

For 1 liter dissolve in H2O:

Compound/Ingredient	Amount required (1L of medium)
Na2HPO4	6 g
KH2PO4	3 g
NaCl	0.5 g
(NH4)Cl	1 g
Agar+	15 g

+ Add agar in case a solid medium is required.

Once broth reaches room temperature, add to the broth in aseptic conditions the following amount of each solution:

Solution	Amount required (1L of medium)
1 M MgSO4	2 mL
1 M CaCl2	0.1 mL
20% Glucose (w/v)*	10 mL
1M Thiamine-HCl	1 mL

* For M9-modified medium no glucose solution is added, instead 10 mL of filtered hydrocarbon/ hydrocarbon mixture are added per liter of medium. Be careful when adding the hydrocarbon/hydrocarbon mixture.

NOTE: Autoclave the solutions 1 M MgSO4, 1M CaCl2, 20% glucose (w/v) (EXCEPT thiamine-HCl 1M) on a liquid cycle. Filter the solution Thiamine-HCl 1M using a 0.22 μm membrane, store the solution in a cold room when is not required.

Store in cold room if the medium is not used.

Antibiotics

Antibiotic	Final concentration in the medium
Ampicillin	100 μg/mL
Kanamycin	50 μg/mL
Chlorampenicol	35 μg/mL
Tetracycline	15 μg/mL

All stock solutions must be kept at -20 ºC and used under aseptic conditions.

SOB

For 1 liter dissolve in H2O: Compound/Ingredient Amount required (1L of medium) Bacto tryptone 20 g Yeast extract 5 g NaCl 0.5 250 mM KCl 10 mL

Adjust pH to 7.0 Before use add 5 mL of 2 mM MgCl2

SOC (Super optimal broth with catabolite repression)

Add 20 mM glucose to 1 L SOB

10x TBE Buffer

For 1 liter, dissolve in 800 mL H2O:

Compound/Ingredient	Amount required (1L of medium)
Tris	54 g
Boric Acid	27.5 g
0.5 M EDTA	4.65 g or 20 mL

Adjust volume to 1 liter with H2O

Primers

Name	Direction	Sequence
G00100	Forward	5’ TGCCACCTGACGTCTAAGAA 3’
G00101	Reverse	5’ ATTACCGCCTTTGAGTGAGC 3’
MF	Forward	5’ TTTCCCAGTCACGACGTTG 3’
MR2	Reverse	5’ GCAAGGAAACAGCTATGACCATG 3’
PCR F	Forward	5’ TCTGAATTCGCGGCCGCTTCT 3’
PCR R	Reverse	5’ GAACTGCAGCGGCCGCTACTAGTA 3’
304F	Forward	5’ CCGTAACCTATGGTGAAAATTTTACTAGAGTCACACAGGAAAGTACTAGTAGCG 3’
304R	Reverse	5’ CGCTACTAGTACTTTCCTGTGTGACTCTAGTAAAATTTTCACCATAGGTTACGG 3’
327F	Forward	5’ CGGTGAAGTTGCATACTATCGATATACTAGAGTCACACAGGAAAGTACTAGTAGCG 3’
327R	Reverse	5’ CGCTACTAGTACTTTCCTGTGTGACTCTAGTATATCGATAGTATGCAACTTCACCG 3’

Team:TU Delft/Protocols

From 2010.igem.org

Contents

Protocols

Use of provided BioBricks

Making competent cells

Transformation Home-Made competent cells

Transformation commercial competent cells

Transformation efficiency (CFU/µG)

Birnboim Plasmid Isolation

QIAGEN Mini-prep plasmid isolation

QIAGEN Midi-prep plasmid isolation

QIAGEN Maxi-prep plasmid isolation

Freezing of bacterial stocks

Restriction enzyme digestion

Ligation

Agarose gel

PCR

Overlapping PCR

Colony PCR

QIAGEN Gel Extraction

Precipitation of PCR products

Protein Purification

Protein content measurements (Bradford Assay)

Emulsifier test

Preparing cell lysates for enzyme kinetics measurements

Buffers and Stock solutions

Luria-bertani (LB)

M9

Antibiotics

SOB

SOC (Super optimal broth with catabolite repression)

10x TBE Buffer

Primers