Team:Freiburg Bioware/testpage

• Materials

Results of agarose-gel:

• Expected fragments of 3677 bp and 974 bp can be cerified. The insertion of the RFC25_MCS has been inserted.
  
For further verification the insert has to be sequenced has to be conducted (to do for 04.06.2010).

Picking clones of Thymindinkinase of Amor

• • 5 clones of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 with the thymidinkinase have been picked from LBamp-agarplates
  • 1 clone of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
  • all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
  • to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)

Idea

• Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
  • New RFC standard with Kozak sequence for eucaryotes??

21. Labortag 04.06.2010: DKFZ plasmid Retrafos, TK/GMK Mini-Prep

Investigators: Adrian, Bea, Chris W., Hanna


DKFZ

Comments: Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.
Plasmids received:


• pXX6 alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
• pKEX-2XL.Rep40 Expressionsplasmide für das Rep Proteine 40
• pKEX-2XL.Rep 52 Expressionsplasmide für das Rep Proteine 52
• pKEX-2XL.Rep 68 Expressionsplasmide für das Rep Proteine 68
• pKEX-2XL.Rep 78 Expressionsplasmide für das Rep Proteine 78
• pCMV-VP(HS) Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
• pKEX-VP1 Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
• pKEX-VP2Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
• pKEX-VP3Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
• pTRUF_CMV_eGFPEinzelstrang Vektor zur Expression von eGFP
• dsAAV_CMV_eGFP"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
• pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
• pDG komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998




• In order to obtain the DNA following steps have been performed:
  • cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
  • put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
  • transfer Whatman paper into Eppi
  • add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
  • centrifuge eppis at 2000 rpm, 10 minutes
• Transformation with obtained plasmids was performed.

Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)

Plasmid Mini-Prep

• experiment date: 04.06.2010 ; time: 3,5h
• name of investigator: Adrian, Bea, ChrisW.,Hanna
• new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)

Glycerol Stocks

Given Plasmid-Number

Nanodrop concentration

• Plasmid
  • Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
  • Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
  • Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
  • Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
  • Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
  • Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;

Comments:A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.
The DNA will be sent to GATC for sequencing.

• pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
• Expected results: Saturday

22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS

Investigators: Adrian, Bea, Melanie, Hanna

Hybridization:

• Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
• Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
  • expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H_{2</sup>O (Volume on obtained sheet)were added.}
  • expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H_{2</sup>O (Volume on obtained sheet)were added.}
• Resuspended DNA was vortexted.
• Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H_{2</sup>O (final volume usually 100 µl).}
• Mix together(into PCR-tube):

• Program: ORIGAMI 1 modified for long oligos:
  • 1 99°C 7’
  • 2 99°C 1’
  • -1°C R=0.3 °/s
  • Goto 2 rep 74
  • Hold 4°C

• While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted
  

following standard protocol for cloning.

Digestion:

• Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
• Plasmid: pAAV_MCS
• Buffer used: 3
• BSA: Yes
• DNA-Concentration: 260 ng/uL
• Restriction-enzyms used:

Enzyme1 (Nr. Lab: 152): ClaI Enzyme2 (Nr. Lab: 15): BglII

• Digestion components :

• Mixture was incubated for 1,5 h at 37°C.

Agarose-Gel:

• 1% agarose gel was prepared, gel ran for 45 minutes(110 V)

• Amount of loading dye added

• Expected size of fragments

</ul>

Gelextraction:

Gel measurement:

• Gelextraction was performed following standard protocol.
• DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL

Ligation:

Trafo was performed (using XL1B cells) following standard protocol.

23. Labortag 07.06.2010: Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)

investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea

pAAV_iGEM-MCS

Plasmid Mini-Prep

• experiment date:07.06.2010; time: whole day
• name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea

Glycerol Stocks

Given Plasmid-Number

Test digestion

• buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
• Plasmid
  • Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
  • Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
  • Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;

Comments:Clone no.1 was dismissed...

Test digestion:

• Incubation: 45 min, 37°C

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes

• Marker: GeneRuler ladder mix

Kleinschmidt-plasmids

Plasmid Mini-Prep

• experiment date: 07.06.2010 ; time: 10 – 20 h
• name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
• Kleinschmidt-plasmids

Glycerol Stocks

Given Plasmid-Number

Comments: Many things went wrong today!

• Glycerol stocks must be vortexted!
• Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
• Always check volumes - try to estimate if volume makes sense (check pipettes!)
• Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!

Today's conclusion: Better ask 2 times than do something wrong without asking!!!

Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)

Quickchange site directed mutagenesis: PCR reaction:

• 2.5 µL 10x Pfu Ultra II buffer
• 0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
• 0.56 µL primer 1 (of 1:10 dilution)
• 0.56 µL primer 2 (of 1:10 dilution)
• 1 µL DMSO (primers form very strong secondary structures)
• 0.5 µL dNTP
• 18.88 µL dH_2</sup>O
• 0.5 µL PfuUltra II fusion (1.25 U)

-> end volume: 25 µL

PCR program:
1 x : 2' 95°C (HotStart polymerase) 20 x : 30 s 95°C -> 1' 55°C -> 5' 68°C 1 x : 4°C (over night)
Experiment will be continued tomorrow.

24. Labortag 08.06.2010: Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis

Investigators: Kira, Jessy, Hanna, Achim

Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):

The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault. All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.

Insertion of mVenus_YFP into pAAV_iGEM-MCS

Digestion:

• Vector: 4,16 µl
• Insert: 4,84 µl

• Vector: 6 µl
• Insert: 3 µl

continuation of site-directed mutagenesis

Digestion with DpnI:

Trafo:

25. Labortag 09.06.2010: pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis

investigators: Jessy, Achim, Sven, Toby, Hanna

No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night!

Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail:

Insertion of mVenus_YFP into pAAV_iGEM-MCS

• experiment date: 9.6.2010
• name of investigator: Sven
• plasmid:
  • Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
  • Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
• new vector name: pAAV_iGEM-MCS_mVenus-YFP
• buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
• DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL

Digestion

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt

Gelextraction

• insert (mVenus-YFP): 26 ng/µL
• vector (pAAV_iGEM-MCS): 30 ng/µL

Ligation

• vector: 5.85 µL
• insert: 3.15 µL
• ligase: 1 µL
• buffer: 10 µL

Test digestion of pAAV_iGEM-MCS

p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>

• buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
• Plasmid
  • Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
  • Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
  • Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;

• Incubation: 1 h, 37°C

Agarose-Gel:

0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes

• Marker: GeneRuler ladder mix

Comments: Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:

• c(P34.3): 408.48 ng/µL
• Volume (plasmid): 5.14 µL
• Volume (vector): 24.86 µL
• Name of eppi: HW_34
• Primer: GATC_std_pTeSp-1

Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

• experiment date: 9.6.2010
• name of investigator: Hanna, Achim
• plasmid:
  • Vector: name: pAAV_iGEM-MCS_Vektor_oben
  • Insert: name: pOG14_mVenus
• new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.

26. Labortag 10.06.2010:

Site-directed mutagenesis of PstI in ITRs

1. Site directed mutagenisis

• Aim: deletion of PstI from both ITR's
• 2 PCR tubes got prepared, one for the left ITR and one for the right. (The SDM was performed according to the standart protocol)
• Media:Freiburg10_Site_directed_Mutagenesis_pAAV_MCS_deletion_PstI.pdf‎

Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion

2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP

Title: pAAV_iGEM_mVenus_
investigator: Jessy, Achim
Glycerol Stocks

Given Plasmid-Number

Title: pAAV_iGEM_mVenus_YFP (guided by Sven)
investigator: Bea Glycerol Stocks

Given Plasmid-Number

2.2 Test digestion

• buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
• Plasmid
  • Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
  • Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
  • Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
  • Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;

Comments: Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.

Investigators: Bea, Chris W.

• Incubation: 45 min, 37°C

27. Labortag 11.06.2010:

Site directed mutagenisis

transformation
transformation was performed according to the standard protocol Media:Freiburg10_Cloning Protocol.pdf
Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.

Sequenzing

p39 was send to GATC for sequenzing

• p39: 180,83 ng*µl^-1
• volume plasmid: 8,3 µl
• volume water: 21,7 µl
• primer: GATC_std_pTeSp-1

28. Labortag 12.06.2010:

Kira
The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday. Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)

29. Labortag 13.06.2010:

Jessy, Patrick, Hanna
We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.

30. Labortag 14.06.2010:

pAAV_iGEM-mVenus-YFP:

The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.

Site-directed mutagenesis:

Also today no colonies were detectable on any plates!

TK-GMK-Plasmid

Adrian, Hanna
puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again:

• name: AF 1
• primer: GATC_std_BGH-reverse
• volume(plasmid) = 4.25 µL
• volume (H_{2</sup>O) = 25.75 µL}

Results (15.06.): Unfortunately just ~ 300 bp were sequenced.

To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct!

Zellkultur

AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion. The Cells were accounted by using the Neubauer-Meteringchamber. After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium. 2,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.

We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.

The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish with 1.5ml. note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.

We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.

31. Labortag 15.06.2010:

Adrian, Achim, Chris W., Hanna

Solutions for transfection were prepared:

• 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H_{2</sup>O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H2</sup>O. Solution was autoclaved (sterilization by filtration is also possible).}
  
• 1 M CaCl2: 147.02 g CaCl2 x 2H_{2</sup>O (M = 147.02 g/mol) was solved in 1 Liter H2</sup>O and sterilized by filtration.}
  
• 2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H_{2</sup>O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.}
  

32. Labortag 16.06.2010:

Sponsoring:

Anna, Kerstin, Anissa
Sponsoring letters were examined and modified one more time.

Sequencing of TK-GMK:

Hanna
Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.

Mega primer PCR:

Bea, Hanna

33. Labortag 17.06.2010:

Primer designing: VP1 primer for pKEX forward/reverse

Investigator: Volker
The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert. These primers will then be used to sequence the inserts of all the constructs.

Forward primer pKEX in VP1 from bp 4124 to 414

• VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; TM: 50°C; CG% 41%

Reverse primer pKEX in VP1 from bp 2081 to 2100

• VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp; TM: 54°C CG%: 60%

The amplicon that should be produced by the primers is 199 bp long.

Primer designing: CMV_forward/reverse_qPCR

Investigator: Volker
Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed. The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.

• CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
• CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'

Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively

These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.

Ordering of required reagents:

Investigator: Volker

• Nuclease S1 was ordered from Promega (10000Units for 36,00€)
• Proteinase K was ordered from Sigma (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)

These reagents are required for the procedure to determine the genomic and the infectious titer.

34. Labortag 18.06.2010: Transfection

Transfection

Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)

investigators: Chris W., Hanna, Patrick, Adrian, Volker
Transfections with the following plasmids:

1)

• pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
• pHelper
• pAAV_RC

2)

• pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 was not sufficient enough for four Transfections!
• pHelper
• pAAV_RC

Plasmid concentrations:
pAAV_RC: 1 µg/µl
pHelper: 280 ng/µl
pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl
pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl

Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38.

Deviations from the standard protocol (currently incomplete): We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.

Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12

Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick

investigator: Bea
idea:

• Digest vector in order to obtain two fragments which contain the left and the right ITR respectively.
• Separation (Agarose-gel) and gel extraction of fragments
• Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)
• to do:
• design primers
• digestion of pAAV_MCS etc.

Theoretical: Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.

Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively