|
|
| Line 1: |
Line 1: |
| - | __NOTOC__
| |
| | <html> | | <html> |
| - | <body style="background-color:#CCCCCC">
| |
| - |
| |
| | <style> | | <style> |
| - | h1.firstHeading { display: none; }
| |
| - |
| |
| - | p {text-align: justify;}
| |
| - |
| |
| - | a:link { color: #FF0000; text-decoration: none}
| |
| - | a:visited { color:#FF0000; text-decoration: none}
| |
| - | a:hover { color:#FF0000; text-decoration: none}
| |
| - | a:active { color:#FF0000; text-decoration: none}
| |
| - |
| |
| - | #bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; }
| |
| - |
| |
| - | table#team_members { text-align: justify; border: 0; }
| |
| - | table#team_members h2, table#team_members h3 { clear: both; }
| |
| - |
| |
| - |
| |
| - | /*-----------------------------------------------------------------------------------------------*/
| |
| - | div.MenuBar ul li ul.DropDownMenu {
| |
| - | display: none; /* Hides all drop-down menus. */
| |
| - |
| |
| - | }
| |
| - | /*
| |
| - | li:hover works in IE7 and FF2.
| |
| - | a:hover works in IE6 and FF2.
| |
| - | a:hover breaks li:hover in FF2.
| |
| - | */
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {
| |
| - | display: none; /* Hides all side menus. */
| |
| - | }
| |
| - | /*------------------------------------------------------------------------------------- Menu Bar */
| |
| - | div.MenuBar {
| |
| - | font: arial, helvetica, sans-serif;
| |
| - | height: 30px;
| |
| - | width: 910px;
| |
| - | /*width: 100%*/
| |
| - | margin: 0;
| |
| - | border-top: 0;
| |
| - | border-right: 0;
| |
| - | border-left: 0;
| |
| - | padding: 0;
| |
| - | background: black;
| |
| - |
| |
| - | }
| |
| - | div.MenuBar ul {
| |
| - | font: arial, helvetica, sans-serif;
| |
| - | text-align: center;
| |
| - | list-style-type: none;
| |
| - | margin: 0.5em auto;
| |
| - | border: 0;
| |
| - | padding: 0;
| |
| - | background: black;
| |
| - | }
| |
| - | div.MenuBar ul li {
| |
| - | font: arial, helvetica, sans-serif;
| |
| - | display: block;
| |
| - | padding: 0;
| |
| - | margin: 0;
| |
| - | font-size: 1.3em;
| |
| - | float: left;
| |
| - | background: black;
| |
| - | text-align: center;
| |
| - | width: 107px;
| |
| - | position: relative; /* Sets the positioning context for each drop-down menu. */
| |
| - | }
| |
| - |
| |
| - | div.MenuBar ul li a {
| |
| - | font: arial, helvetica, sans-serif;
| |
| - | display: block;
| |
| - | background: black;
| |
| - | height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */
| |
| - | color: #ffffff;
| |
| - | padding-top: 4px;
| |
| - | padding-bottom: 4px;
| |
| - | padding-left: 1em; /* Sets the left space between top-level items. */
| |
| - | padding-right: 1em; /* Sets the right space between top-level items. */
| |
| - | text-decoration: none;
| |
| - | }
| |
| - |
| |
| - | /*------------------------------------------------------------------------------ Drop-Down Menus */
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu {
| |
| - | display: block;
| |
| - | width: 10em; /* Drop-down menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | height: 1em;
| |
| - | padding: 1px; /* Sets the drop-down menu "effective border" width. */
| |
| - | position: absolute;
| |
| - | top: 23px; /* Places the drop-down menu under the menu bar.
| |
| - | Keep it sync with the menu bar height. */
| |
| - | left: 0; /* Aligns the drop-down menu to its top-level item. */
| |
| - | background-color: black; /* Selected item. */
| |
| - | color: #FFFFFF;
| |
| - |
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a {
| |
| - | width: 10em; /* Keep it sync with the drop-down menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | height: 1em;
| |
| - | padding-left: 0;
| |
| - | padding-right: 0;
| |
| - | background-color: black; /* Selected item. */
| |
| - | color: #FFFFFF;
| |
| - | }
| |
| - | ul.DropDownMenu li a span {
| |
| - | display: block;
| |
| - | padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */
| |
| - | padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */
| |
| - | text-align: right; /* Aligns the >> symbol to the right. */
| |
| - | }
| |
| - | ul.DropDownMenu li a span span {
| |
| - | float: left; /* Aligns the text (back) to the left. */
| |
| - | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
| |
| - | height: 20px;
| |
| - | color: #FFFFFF;
| |
| - | }
| |
| - | /*----------------------------------------------------------------------------------- Side Menus */
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| |
| - | display: block;
| |
| - | width: 11em; /* Side menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | padding: 1px; /* Sets the side menu "effective border" width. */
| |
| - | position: absolute;
| |
| - | top: -1px; /* Aligns the side menu to its drop-down menu item.
| |
| - | Keep it sync with the side menu "effective border" width. */
| |
| - | left: 13em; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| |
| - | width: 11em; /* Keep it sync with the side menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
| |
| - | left: 13em; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | }
| |
| - | div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {
| |
| - | padding-left: 1.5em; /* Sets the left space of each side menu item. */
| |
| - | padding-right: 0.5em; /* Sets the right space of each side menu item. */
| |
| - | text-align: left;
| |
| - | font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
| |
| - | left: 13em; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width.
| |
| - | Use MenuTailor.css to customize. */
| |
| - | }
| |
| - | /*----------------------------------------------------------------------------- Browser Specific */
| |
| - | * html div.MenuBar ul li a {
| |
| - | float: left; /* Required for IE55 and IE6.
| |
| - | Breaks O9.
| |
| - | Hidden (* html) from non-IE browsers. */
| |
| - | }
| |
| - | * html ul.DropDownMenu li a:hover {
| |
| - | cursor: hand; /* Required for IE55.
| |
| - | Hidden (* html) from non-IE browsers. */
| |
| - | }
| |
| - | ul.DropDownMenu li a:hover {
| |
| - | cursor: pointer; /* Required for IE6 and IE7.
| |
| - | Hidding it (* html) from non-IE browsers breaks IE7!
| |
| - | }
| |
| - | * html div.MenuBar a:hover {
| |
| - | text-decoration: none; /* Required for IE55 and IE6.
| |
| - | Hidden (* html) from non-IE browsers. */
| |
| - | }
| |
| - | * html div.MenuBar ul li table,
| |
| - | * html div.MenuBar ul li table td {
| |
| - | border: 0; /* Required for IE55 and IE6.
| |
| - | Hidden (* html) from non-IE browsers. */
| |
| - | }
| |
| - | /*------------------------------------------------------------------------------- Default Colors */
| |
| - | div.MenuBar {
| |
| - | background-color: Menu;
| |
| - | border-bottom: 1px solid ButtonShadow;
| |
| - | }
| |
| - | div.MenuBar a {
| |
| - | background-color: Menu; /* Top-level unselected items. */
| |
| - | color: MenuText;
| |
| - | }
| |
| - | div.MenuBar ul li:hover a,
| |
| - | div.MenuBar ul li a:hover {
| |
| - | color: #ea7f16;
| |
| - | background-color: Highlight; /* Top-level selected item. */
| |
| - | color: HighlightText;
| |
| - | }
| |
| - | /*...............................................................................................*/
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu {
| |
| - | background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a {
| |
| - | background-color: Menu; Drop-down menu unselected items.
| |
| - | Sets the drop-down menu "effective background" color. */
| |
| - | color: MenuText;
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {
| |
| - | background-color: Highlight; /* Drop-down menu selected item. */
| |
| - | color: HighlightText;
| |
| - | }
| |
| - | /*...............................................................................................*/
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| |
| - | background-color: ButtonShadow; /* Sets the side menu "effective border" color. */
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| |
| - | background-color: Menu; /* Side menu unselected items.
| |
| - | Sets the side menu "effective background" color. */
| |
| - | color: MenuText;
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
| |
| - | background-color: Highlight; /* Side menu selected item. */
| |
| - | color: HighlightText;
| |
| - | }
| |
| - | /*-----------------------------------------------------------------------------------------------*/
| |
| - | /*Script-Free 3-Level Menu 1.2 Tailor
| |
| - | www.CesarDaniel.info
| |
| - | /*-------------------------------------------------------------------------------------- General */
| |
| - | body {
| |
| - | background: white;
| |
| - | color: black;
| |
| - | margin: 0;
| |
| - | border: 0;
| |
| - | padding: 0;
| |
| - | }
| |
| - |
| |
| - |
| |
| - | div.MenuBar {
| |
| - | font: 13px arial, helvetica, sans-serif;
| |
| - | }
| |
| - | div.MenuBar ul {
| |
| - | font: 13px arial, helvetica, sans-serif; /* Required for IE55. */
| |
| - | }
| |
| - | /*--------------------------------------------------------------------------------------- Colors */
| |
| - | div.MenuBar {
| |
| - | background-color: black; /* Selected item. */
| |
| - | color: #FFFFFF;
| |
| - | border-bottom: 1px solid ButtonShadow;
| |
| - | }
| |
| - | div.MenuBar a,
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a,
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
| |
| - | background-color: black; /* Selected item. */
| |
| - | color: #FFFFFF;
| |
| - | }
| |
| - | div.MenuBar ul li:hover a,
| |
| - | div.MenuBar ul li a:hover,
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
| |
| - | background-color: #FF0000; /* Selected item. */
| |
| - | color: #FFFFFF;
| |
| - | }
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu,
| |
| - | div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
| |
| - | div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
| |
| - | background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */
| |
| - | }
| |
| - | /*--------------------------------------------------------------------------------------- Widths */
| |
| - | /*
| |
| - |
| |
| - | /*
| |
| - | Menu Bar 1
| |
| - | Drop-Down Menu #2
| |
| - | */
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {
| |
| - | width: 11em; /* Drop-down menu width. */
| |
| - | }
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {
| |
| - | width: 12em; /* Drop-down menu width. */
| |
| - | }
| |
| - |
| |
| - | /*...............................................................................................*/
| |
| - | /*
| |
| - | Menu Bar 1
| |
| - | Drop-Down Menu #2
| |
| - | Side Menu #1
| |
| - | */
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {
| |
| - | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width. */
| |
| - | }
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {
| |
| - | width: 10em; /* Side menu width. */
| |
| - | }
| |
| - | /*...............................................................................................*/
| |
| - | /*
| |
| - | Menu Bar 1
| |
| - | Drop-Down Menu #2
| |
| - | Side Menu #2
| |
| - | */
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {
| |
| - | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width. */
| |
| - | }
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {
| |
| - | width: 10em; /* Side menu width. */
| |
| - | }
| |
| - | /*...............................................................................................*/
| |
| - | /*
| |
| - | Menu Bar 1
| |
| - | Drop-Down Menu #2
| |
| - | Side Menu #3
| |
| - | */
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {
| |
| - | left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
| |
| - | Keep it sync with the drop-down menu width. */
| |
| - | }
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,
| |
| - | div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,
| |
| - | div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {
| |
| - | width: 10em; /* Side menu width. */
| |
| - | }
| |
| - | /*...............................................................................................*/
| |
| | | | |
| | + | table.calendar { margin: 0; padding: 10px; } |
| | + | table.calendar td { margin: 0; padding: 2px; vertical-align: top; } |
| | + | table.month .heading td { padding:2px; background-color:#CCCCCC; color:#000000; text-align:center; font-size:120%; font-weight:bold; } |
| | + | table.month .dow td { color:#3C1859; text-align:center; font-size:110%; } |
| | + | table.month td.today { background-color:none; } |
| | + | table.month td { |
| | + | border: none; |
| | + | margin: 0; |
| | + | padding: 1pt 1.5pt; |
| | + | font-weight: bold; |
| | + | font-size: 8pt; |
| | + | text-align: right; |
| | + | background-color: #eee; |
| | + | } |
| | + | #bodyContent table.month a { background:none; padding:0 } |
| | + | .day-active { color:#FF0000 } |
| | + | .day-empty { color:#000000 } |
| | </style> | | </style> |
| - |
| |
| - |
| |
| - | <body>
| |
| - | <div id="header"><img src="https://static.igem.org/mediawiki/2010/3/31/RMIT_logo.png" /></div>
| |
| - | <div class='MenuBar' id="navi">
| |
| - | <ul>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia" style="color: white">Home
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - | </li>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Team" style="color: white">Team
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - | </li>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Project" style="color: white">Projects
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - |
| |
| - | </li>
| |
| - | <li>
| |
| - |
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Parts" style="color: white">Parts
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - | </li>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Modeling" style="color:white">Modelling
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - | </li>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Notebook" style="color: white">Notebook
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - |
| |
| - |
| |
| - | </li>
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Safety" style="color: white">Safety
| |
| - | <!--[if gt IE 6]><!--></a><!--<![endif]-->
| |
| - | <!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
| |
| - | <!--[if lte IE 6]></td></tr></table></a><![endif]-->
| |
| - | </li>
| |
| - |
| |
| - | <li>
| |
| - | <a href="https://2010.igem.org/Team:RMIT_Australia/Sponsors" style="color: white">Sponsors</a>
| |
| - | </li>
| |
| - | </ul>
| |
| - |
| |
| - | </div>
| |
| - | <div id="header_bottom"><img src="https://static.igem.org/mediawiki/2008/e/ef/Navi_bg.gif" alt="" / ></div>
| |
| - | </body>
| |
| | </html> | | </html> |
| | | | |
| | + | __NOTOC__ |
| | + | =='''Notebook'''== |
| | + | {| align="center" |
| | + | |-valign="top" |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=05}} |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=06}} |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=07}} |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=08}} |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=09}} |
| | + | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=10}} |
| | + | |} |
| | + | {| |
| | + | |-valign="top" border="0" |
| | + | |width="100%" style="padding: 0 20px 0 0;"| |
| | | | |
| | | | |
| | | | |
| - | == '''The Story So Far'''== | + | {|style="text-align:center"; width="100%" |
| - |
| + | |- |
| | + | |-valign="top" |
| | + | |width="50%" | |
| | + | <div id=" .2F1_May_2010"></div> |
| | + | <div id=" .2F2_May_2010"></div> |
| | + | <div id=" .2F3_May_2010"></div> |
| | + | <div id=" .2F4_May_2010"></div> |
| | + | <div id=" .2F5_May_2010"></div> |
| | + | <div id=" .2F6_May_2010"></div> |
| | + | <div id=" .2F7_May_2010"></div> |
| | + | <div id=" .2F8_May_2010"></div> |
| | + | <div id=" .2F9_May_2010"></div> |
| | + | <div id=" .2F10_May_2010"></div> |
| | + | <div id=" .2F11_May_2010"></div> |
| | + | <div id=" .2F12_May_2010"></div> |
| | + | <div id=" .2F13_May_2010"></div> |
| | + | <div id=" .2F14_May_2010"></div> |
| | + | <div id=" .2F15_May_2010"></div> |
| | + | <div id=" .2F16_May_2010"></div> |
| | + | <div id=" .2F17_May_2010"></div> |
| | + | <div id=" .2F18_May_2010"></div> |
| | + | <div id=" .2F19_May_2010"></div> |
| | + | <div id=" .2F20_May_2010"></div> |
| | + | <div id=" .2F21_May_2010"></div> |
| | | | |
| - | {| border="0" cellpadding="10" | align="center"
| |
| - | |{{#calendar: title=RMIT_Australia|year=2010 | month=06}}
| |
| - |
| |
| - | |{{#calendar: title=RMIT_Australia|year=2010 | month=07}}
| |
| - |
| |
| - | |{{#calendar: title=RMIT_Australia|year=2010 | month=08}}
| |
| - |
| |
| - | |{{#calendar: title=RMIT_Australia|year=2010 | month=09}}
| |
| - |
| |
| - | |{{#calendar: title=RMIT_Australia|year=2010 | month=10}}
| |
| | |} | | |} |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | ===16th July===
| |
| - |
| |
| - | The project outline has been put online.
| |
| - | Symon has begun outlining the human practices side of the project.
| |
| - |
| |
| - | ===2nd July===
| |
| - |
| |
| - | Primers for Quikchange mutagenesis were designed to turn the -35 and -10 element into restriction sites.
| |
| - |
| |
| - | '''-35'''
| |
| - | *F 5' tcattaggcaccccaggccttaagctttatgcttccggctcg 3'
| |
| - | *R 5' cgagccggaagcataaagcttaaggcctggggtgcctaatga 3'
| |
| - |
| |
| - | '''-10'''
| |
| - | *F 5' gctttatgcttccggctcggatcctgtgtggaattgtgagcgg 3'
| |
| - | *R 5' ccgctcacaattccacacaggatccgagccggaagcataaagc 3'
| |
| - |
| |
| - | ===1st July===
| |
| - |
| |
| - | Designing the protein expression vector. The two characteristics that we are looking for are:
| |
| - | *Strong promoter
| |
| - | *Inducible
| |
| - |
| |
| - | In order to achieve these two aims, we will use the biobrick '''BBa_R0010''' which is an (lac) inducible promoter and incorporate a T7 promoter to it. This process involves the removal of the -35 and -10 promoter sites and the incorporation of the T7 promoter sequence.
| |
| - |
| |
| - | By mutagenesis we aim to turn the promoter elements into restriction sites (which are not found in the plamsid), thus being able to remove the promoter section and then introducing the T7 promoter sequence by ligation.
| |
| - |
| |
| - | <center> 5' ACCCCAGGC'''TTTACA'''CTTTATGCTTCCGGCTCG'''TATGT'''TGTGTGGAATT 3' </center>
| |
| - |
| |
| - | In bold are the -35 and -10 promoter sites (respectively). The -35 element can be mutated into the AflII restriction site (''c.ttaag''), while the -10 element will be mutated into the BamH1 restriction site (''g.gatcc'').
| |
| - |
| |
| - | ===30th June===
| |
| - |
| |
| - | We found the ''T.aquaticus'' DNA polymerase sequence from the NCBI website. From this, we designed primers that contained restriction site "sticky ends" on the 5' and 3'. The restriction sites that are going to be used for introducing Taq into the vector are XbaI (5') and SpeI (3').
| |
| - |
| |
| - | '''Forward primer:'''
| |
| - |
| |
| - | 5' CTA GAA TGA GGG GGA TGC TGC CCC TCT TTG AG 3'
| |
| - |
| |
| - | Length: 32 <br>
| |
| - | GC Content: 56.3 % <br>
| |
| - | Tm: 65.6 ºC
| |
| - |
| |
| - |
| |
| - | '''Reverse Primer:'''
| |
| - |
| |
| - | 5' GAT CAT CAC TCC TTG GCG GAG AGC CAG TCC 3'
| |
| - |
| |
| - | Length: 30 <br>
| |
| - | GC Content: 60.0 % <br>
| |
| - | Tm: 66.2 ºC
| |
| - |
| |
| - |
| |
| - | Due to the high GC content of the Taq gene, the Tm of the primer is very high. A two step PCR reaction might be needed.
| |
| - |
| |
| - | ===29th June===
| |
| - |
| |
| - | The team is starting to design the experiment.
| |
| - | We need to:
| |
| - | * Design primers to introduce Taq into psB1C3
| |
| - | * Create a good protein expression vector.
| |
| - |
| |
| - | ===22th June===
| |
| - |
| |
| - | Work has begun on creating primers to extract the protein we are working on from its wild-type plasmid into a plasmid which conforms to biobrick cloning standards.
| |
| - |
| |
| - | ===19th June===
| |
| - |
| |
| - | Jeremy Nagels, a student at Monash university, Ebony and Symon have begun discussing various project ideas. These include:
| |
| - |
| |
| - | Oscillators
| |
| - |
| |
| - | The use of the Hydrogenase 3 complex to generate Hydrogen within E Coli as a form of biofuel.
| |
| - |
| |
| - | The possibility of biological prevention of tooth decay with biobricks.
| |
| - |
| |
| - | The application of biobricks to a mixed cell community.
| |
| - |
| |
| - | The development of cell free transcription/ translation within a cellular system, for example the phloem of a plant, (although the development of this level of symbiosis may be the stuff of future projects)
| |
| - |
| |
| - | The attempt is being made to develop a project that in some ways reflects these interests and possibly taps a common thread underlying them.
| |
"
