"

From 2010.igem.org

---

Revision as of 00:41, 28 October 2010

Engineering of the miTuner Kit

All basic parts in the miTuner Kit were amplified by PCR and cloned into standard vector backbone pSB1C3. The miTuner construct was then assembled by applying the iGEM assembly protocol. Thereby, a whole kit of parts was constructed in BB-2 (RFC12) standard, enabling for easy reuse of the miTuner kit in different contexts (i.e. different promoters, cDNAs).

Engineering of synthetic microRNAs

The microRNAs we propose here can be used in the miTuner constructs, but can also applied in other contexts. If microRNAs with costumized targets are required, online tools, such siRNA Wizard v3.1 can be applied. siRNA Wizare allows the creation of a list of siRNAs that can down-regulate your gene of interest without the problem of off-targeting within the organism you selected. For our purposes the lac-Z gene from the lac operon (E. coli) was used in order to create a list of siRNAs that were then adopted to the hsa-miR122 sequence. Default settings were used and the above mentioned siRNA did not have off targets either in humans and mice.
MicroRNAs SHOULD be constructed using the has-mir122 template (Part Nr. BBa_K337016), in order to bring the synthetic microRNA into an appropriate context and enable driving the expression with normal Pol-II promoters. Customized guiding and passenger strand can be introduced via the following miR fusion PCR protocol (shown by the example of a synthetic microRNA): Desired customized microRNA sequence (guiding strand, loop, passenger strand):
5’…GGAGGTGAAGTTAACACCTTCGTGGCTACAGAGTTTCCTTAGCAGAGCTGGACACCACGGCCAC CGATATTATGTCTAAACTATTAATATCGGTGACCGTGGTACCAGCTACTGCTAGGCAATCCTTCCCT CGATAAATGTCTTGGCATCGTTTGCTT …3’
Oligos needed:
miRNA_fusion_fw: ATTATGTCTAAACTATTAATATCGGTGACCGTGGTACCTAGCTACTGCTAGGC
miRNA_fusion_rev: ATTAATAGTTTAGACATAATATCGGTGGCCGTGGTGTCCAGCTCTGCTAAGG
miRNA_AflII_fw: ttttctgcagcggccgcgcgctagccttaagTGGAGGTGAAGTTAACACCTTCGTG
miRNA_HindIII_rev: ttttGAATTCGCGGCCGCACTAGTaagcttAAGCAAACGATGCCAAGACATTTATCG

1) Two separate PCR reactions have to be performed, using 50 ng of part BBa_K337016 as template with primer pairs
miRNA_fusion_fw/miRNA_HindIII_rev and miRNA_fusion_rev/miRNA_AflII_fw. PCR SHOULD be performed in a total volume of 50 µl,
using Phusion HF (high fidelity) PCR Mastermix. Touchdown PCR SHOULD be performed according to the following protocol:
95 °C/5 min
...................................... 1x
95 °C/ 30 s
68 °C (- 0.5 °C/cycle)/ 30 s
72 °C/ 15 s
...................................... 16x
95 °C/ 30 s
60 °C/ 30 s
72 °C/ 15 s
...................................... 19x
72 °C/ 5 min
...................................... 1x
4 °C/ forever

Alternatively, a PCR protocol with constant annealing temperature at 60 °C over thirty cycles MAY also be applied.


2) A nucleotide removal kit should be applied for purifying the PCR products (~ 100 bp in size). 3-5 µl of the first PCR
reaction MAY be analyzed on a 2 % agarose gel. 50 ng of each first PCR product should be applied in a second PCR reaction
with primers miRNA_fusion_fw and miRNA_fusion_rev for obtaining the whole microRNA sequence (200 bp band).

3) The PCR product should be purified by applying a PCR purification kit and be analyzed on a 1.5 % agarose gel. The purified
product SHOULD be digested with HindIII first and subsequently with AflII and cloned into the destination miTuner plasmid
(BBa_K337036) precut with the same enzymes.

4) Selection of the synthetic microRNA via colony PCR MAY be performed by using primers miRNA_fusion_rev and standard primer
VF2 at 60 °C annealing temperature.

As synthetic microRNA, we used the miRsAg and shRNAmir_hAAT (against human alpha-antitrypsin).

Engineering of synthetic microRNA binding sites

We followed two different approaches for generating synthetic microRNA binding sites: a rational approach and a library-based
approach.
== rational binding site design approach ==

We designed microRNA bindings sites in order to obtain a broad range of caused knockdowns. Therefor, microRNAs having different
binding properties to the corrsesponding microRNAs were designed. As the seed region (nucleotides 2-8 in the 3' sequence of
the binding sites) is very critical for a successful target recognition by the microRNA, Nucleotides number 1-8 3' of the
microRNA binding site were constructed to offer a perfectly matching target.
In order to achieve different binding site strength, we constructed a set of 11 binding sites against the miRsAg and shRNAmir_hAAT
synthetic microRNAs according to the following rules:

Swapping of nucleotides is indicated by arrows. (A<-->T): A is exchanged by T and vice verca for missmatch introduction.
1) perfect binding sites
2) missmatch introduced at position 10, (A<-->T, C<-->G)
3) missmatch introduced at position 10, (A<-->C, T<-->G)
4) missmatch introduced at position 11 (A<-->T, C<-->G)
5) missmatch introduced at position 11, (A<-->C, T<-->G)
6) bulge from position 10-12, (A<-->T, C<-->G)
7) bulge from position 10-12, (A<-->C, T<-->G)
8) bulge from position 9-12, (A<-->T, C<-->G)
9) bulge from position 9-12, (A<-->C, T<-->G)
10) bulge from position 16-18, (A<-->T, C<-->G)