Team:ULB-Brussels/H2

From 2010.igem.org

(Difference between revisions)

Revision as of 23:44, 27 October 2010

Hydrogen production

E. coli naturally produces hydrogen through the mixed acid fermentation. Our goal in this part of the project is to increase the H2 production by modifying the carbon flow through the pathway of the mixed acid fermentation (MAF). The pathways of this fermentation are quite simple. Phosphoenolpyruvate (PEP), which is produced by the glycolysis, is transformed into pyruvate or into oxaloacetate. Those two molecules are then transformed into several products after a chain of reactions. Hydrogen is one of those products. It is produced from formate to regulate the intracellular pH of the bacteria [1].

Here is a simplified global overview of the mixed acid fermentation (fig.1):

Fig. 1 : Mixed acid fermentation pathway [2].

EEach reaction is controlled by one or several enzymes. By overexpressing or deleting specific genes of the MAF pathway, we expect to increase the hydrogen production. The part of MAF pathway in which we are interested is indicated by red lines (fig. 2).

Fig. 2: The interesting pathway for hydrogen production via the mixed acid fermentation.

All the reactions crossing the red lines should be avoided or limited, and the three main reactions which lead to hydrogen production should be increased. The hydrogen is produced from formate by the formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex composed of the formate dehydrogenase (FDHH) and the hydrogenase 3 [1]. This complex catalyzes the following reaction:

Formate + H+ <=> H2 + CO2

Hydrogen is not excreted outside of the cell but it is immediately consumed by two uptake hydrogenases, the hydrogenase 1 and 2 [1][2]:

A menaquinone + H2 + 2H+ <=> A menaquinol + 2H+

The expression of the FHL system is activated at the level of transcription by the FhlA activator (formate hydrogen-lyase transcriptional activator). Expression of fhlA is positively regulated by FNR and repressed by HycA [1]. FNR is the main transcriptional regulator that mediates the transition between aerobic and anaerobic growth through the regulation of hundreds of genes [2]. All the regulations linked to the transformation of formate into hydrogen are shown here (fig.3):

Fig. 3 : Regulation of hydrogen production in E.coli [1].

MAF pathway modification: genes to delete

Several steps of the MAF pathway are irrelevant for hydrogen production (fig. 2). To inactivate these reactions, the genes encoding enzymes that catalyze these reactions have to be deleted using the technique described in the homologous recombination module. After exhaustive analyzes of the literature, we decided which genes we would overexpress and which we would disrupt. Here is the list of all the genes that we planned to delete. By using the KEIO Collection database, we checked that none of those genes were essential [4].

ppc

The ppc gene encodes the phosphoenolpyruvate carboxylase enzyme (Ppc). This enzyme catalyzes the following reaction [2]:

Phosphoenolpyruvate + CO2 + H2O <=> Oxaloacetate + Phosphate + H+

Deletion of the ppc gene will therefore prevent the PEP to be transformed into oxaloacetate which is not interesting for our application. As shown on figures 1 and 2, the left part of the MAF pathway does not lead to hydrogen production. Thus, deletion of ppc will inactivate this part of the pathway and all the PEP will be transformed into pyruvate.

ldhA

Pyruvate is transformed into (R)-lactate or into formate + acetyl-CoA. The second reaction is interesting for our application. The first reaction is mediated by the D-lactate dehydrogenase (LdhA) which catalyzes the following reaction:

NADH + Pyruvate + H+ <=> NAD+ + (R)-lactate

Deletion of ldhA should ensure that all the pyruvate is transformed into formate + acetyl-CoA.

focA

The focA gene encodes for a formate transporter located in the plasmic membrane. FocA transports formate outside the cell. It has been shown that disabling this transporter increases the intracellular formate concentration [5]. A higher formate intracellular concentration is obviously interesting for hydrogen production.

hyaB and hybC

To prevent hydrogen uptake by the two hydrogenases, HyaB and HybC, we have to inactivate them. Both hydrogenases-encoding genes are located in operons. The hya operon is composed of 6 genes (from hyaA to hyaF). The hyaB gene encodes the largest subunit of the hydrogenase [2]. This subunit is required for the hydrogenase to be functional [2]. Deleting this gene should inactivate the hydrogenase 1 [1].

The second hydrogenase-encoding gene is located in an operon composed of 7 genes (from hybA to hybG). The hybC gene encodes the largest subunit of the second hydrogenase. As for hyaB, deleting the gene encoding the largest subunit should inactivate it [1].

Materials and methods

Gene deletion by the λ phage Red system

In order to delete the five genes listed above, we used a method based on the λ phage Red system. As this method is described in great details in the ‘homologous recombination module’, we will briefly summarize it here. This method consists in the production of a gene-specific PCR fragment which contains an antibiotic resistance gene and site-specific recombination sites (FRT) flanking this gene. This PCR fragment is then electroporated in a strain containing the plasmid helper λ (PH λ) (see homologous recombination module). This plasmid encodes the genes of the Red system. The target gene is replaced by the resistance gene through homologous recombination using the Red system. We worked with two different antibiotic resistances: chloramphenicol (cm) and kanamicine (kan).
The antibiotic resistance cassette is eventually removed by site-specific recombination using the Flp recombinase. This method leads to the ‘clean’ deletion of the gene of interest without any traces of antibiotic resistance gene. It is also adapted to delete genes in operons since the resistance-FRT cassettes used in this work also contain translation signal (RBS). This allows a proper expression of the genes downstream of the deletion (no polar effect). The primers used deleting the 5 genes of interest are listed in Table 1.

Phage P1 transduction

P1vir stock :
Overnight cultures of the donor strain are diluted 100 fold in 20 ml of LB medium supplemented with MgSO4 10-2M and of CaCl2 5.10-3M and grown at 37°C. At an optical density at 600nm of 0.2, 10µl of a P1 vir stock is added (approximately 109 pfu/ml). Once the bacteria are lysed, 1/20 (v/v) of chloroform is added and the culture is vigorously shacked. The mix is centrifuged at 4°C at 3,700 g and the supernatant is conserved at 4°C. 1/20 of the total volume of chloroform is added and vigorously shacked, then centrifuged again in the same conditions. The surnageant containing the P1 particles is stored at 4°C.
P1vir transduction :
Overnight culture of the recipient strain is pelleted and resuspended in the same volume of MgSO4 10-2M and of CaCl2 5.10-3M. To 100µl of the resuspended pellet, 100µl and 10µl of the P1 lysat is added. The mix is conserved 30 min at 37°C. 3 ml of agar 0.7% is added as well as 100µl of Na citrate 1M. The entire mix is plated on selective plates at 37°C for 16h. The candidates are streaked 3 times on selective plates and a PCR is then performed to confirm the transduction of the marker of interest.

Results

Deletion of the ldhA gene by homologous recombination

The amplification of the resistance cassettes with the primers specific to our 5 genes of interest by PCR took us a little more than a week. Because of the size of the primers used, we had to try several times the PCR and vary the parameters.
Here is the picture of the electrophoresis of those PCR for the 5 genes:

For each genes we tried to obtain both chloramphenicol (about 1100bp) and kanamicine (about 1500bp) resistance cassettes. From left to right we have the genes ldhA (1 and 2), focA (4 and 5), ppc (7 and 8), hybC (10 and 11) and hyaB (13 and 14). The sinks 3, 6, 9, 12 and 15 are the five negative controls.
Once we obtained these cassettes, it took us about 1 month to obtain our first deletion candidate. The electroporation efficiency of the MG1655/PHl strain was not good. We obtained a lot of false-positive deletion candidates (i.e. clones growing on the selective medium). As explained in the homologous recombination module, we had to purify at least three times each candidate (this process takes therefore at least 3 days) before checking the deletion/insertion of the resistance cassette. Using primers complementary to the flanking regions of the genes of interest, PCR were performed on candidate colonies (data shown below). Unfortunately, the candidates were most of the time wild-type for the gene of interest. Our hypothesis is that the resistance cassette was inserted at another location in the genome. The reason for that is unknown since the genes of interest are not essential for E. coli viability, at least in the conditions we used.
After several weeks of unsuccessful attempts, we finally obtained the MG1655 DldhA::cm strain. Here is the picture of the electrophoresis where we tested different deletion candidates:

The sinks we are interested in are the 4 first ones. The wild type version of the gene ldhA is in the third sink. The two first sinks are the deletion candidates for ldhA with the cm resistance cassette. The fourth sink is the negative control for this gene. For information, the other sinks are the tests for the 4 other genes: 5 and 6 are the deletion candidates for ppc; 9 and 10 are the deletion candidates for focA; 17 and 18 are the deletion candidates for hybC: 21 and 22 are the deletion candidates for hyaB. Unfortunately, the cm resistance cassette (about 1100 bp) and the gene ldhA (990 bp) have approximately the same length. In order to testify if we really had the MG1655 DldhA::cm strain, we did a test with a restriction enzyme which cut the gene ldhA.
The result of this test is shown here:

After the purification process, we had 4 candidates for the MG1655 DldhA::cm strain. For those 4 candidates, we did a PCR on the gene ldhA (not knowing if it really was ldhA or the cm resistance cassette that we amplified) and we digest the product of the PCR with an enzyme which cut ldhA. The digested gene ldhA is in the sink 7, the digested cm resistance cassette is in the sink 6. The four digested candidates are in the 4 first sinks. The result is therefore a success, because the candidates are not digested like ldhA. The wild-type version of the gene has been successfully replaced with the cm resistance cassette. We have our MG1655 DldhA::cm strain.

Construction of the MG1655 Dppc::kan, MG1655 DfocA::kan, MG1655 DhyaB::kan, MG1655 DldhA::cm Dppc::kan, MG1655 DldhA::cm DfocA::kan andMG1655 DldhA::cm DhyaB::kan mutant strains by P1 transduction

By that time, we obtained the KEIO strains deleted for our 5 genes of interest. We were thus able to make a P1 stock on these strains (see materials and methods) and to transduce the Dppc::kan, DfocA::kan, DhyaB::kan and DhybC::kan markers in the MG1655 wild-type strain and in the MG1655 DldhA::cm strain. We obtained 6 mutant strains: the single MG1655 Dppc::kan, MG1655 DfocA::kan and MG1655 DhyaB::kan mutant strains as well as the double MG1655 DldhA::cm Dppc::kan, MG1655 DldhA::cm DfocA::kan andMG1655 DldhA::cm DhyaB::kan mutant strains. These strains were checked by PCR.
The results are shown here:

For each strain tested, we have: four candidates, one negative control and the wild type version of the gene that is supposed to have been deleted. If the amplified DNA segment of a candidate has the size of the reistance cassette instead of the size of the wild type version of the gene, the candidate is a mutant. Here are the results:

From 1 to 6 is the test for the MG1655 DhyaB::kan mutant: the 4 candidates are mutants.
From 8 to 13 is the test for the MG1655 DldhA::kan mutant: the candidates in the sinks 10 and 11 are mutants.
From 17 to 22 is the test for the gene ldhA of the double MG1655 DldhA::cm Dppc::kan mutant: the 4 candidates are mutants.
From 24 to 29 is the test for the gene ldhA of the double MG1655 DldhA::cm DfocA::kan mutant: the 4 candidates are mutants.
From 33 to 38 is the test for the gene focA of the double MG1655 DldhA::cm DfocA::kan mutant: the candidates in the sinks 35 and 36 are mutants.
From 40 to 45 is the test for the gene ppc of the double MG1655 DldhA::cm Dppc::kan mutant: the candidates in the sinks 40, 42 and 43 are mutants.

We managed to obtain different double mutant strains, ready for another transduction. Unfortunately, due to the lack of time we were unable to continue our progression and we were also unable to characterize the double mutant strains for growth in different medium, at different temperature, …

MAF pathway modification: Genes to overexpress

In order to enhance hydrogen production, we proposed to over-express some genes involved in the hydrogen production. Three steps in the mixed acid fermentation pathway are of interest:

The transformation of phosphoenolpyruvate into pyruvate:

Phosphoenolpyruvate + ADP + 2H+ <=> Pyruvate + ATP

This reaction is present in other pathway. We thus decided not to improve it assuming it will not be the limiting step.

The transformation of pyruvate into formate:

Pyruvate + Coenzyme A <=> Formate + Acetyl-CoA

This reaction is catalyzed by two pyruvate formate lyase: PflB and TdcE. The formate is the key molecule for hydrogen production and intracellular elevated formate concentration is needed for an efficient hydrogen production [6].

The transformation of formate into hydrogen:

Formate + H+ <=> CO2 + H2

This reaction is under the control of the FHL complex (formate hydrogenase lyase composed of the formate dehydrogenase (FDHH) and the hydrogenase 3). As stated above, the FHL complex is regulated by FNR, a transcriptional regulator that mediates the transition between aerobic and anaerobic growth, and repressed by HyaC. It has been showed that FHL activity is not the limiting step for hydrogen production. We decided not to over-express the two enzymes of the FHL complex [3].
On the basis of these three reactions, we decided to overexpress the following genes:

fnr

fnr is quite an obvious choice for the first gene to overexpress. FNR is the main transcriptional regulator that mediates the transition from aerobic to anaerobic growth [2]. The concentration of the FNR protein is similar under aerobic and anaerobic conditions. The regulation occurs at the level of FNR activity: in the presence of O2, FNR is inactivated. Under anaerobic conditions, FNR is functional and activates expression of hundreds of genes involved in anaerobic metabolism. In these conditions, FNR represses genes involved in aerobic metabolism [2]. Over-expressing the fnr gene should increase FNR concentration and should thus enhance the anaerobic metabolism. The three reactions of the mixed acid fermentation pathway leading to hydrogen described above should therefore be increased.

pflB

The pflB gene encodes one of the two pyruvate formate lyases which catalyze the transformation of pyruvate into formate [2]. This reaction is the most important one for hydrogen production. Over-expressing pflB should increase formate concentration and therefore hydrogen production. Although pyruvate is the substrate for many other reactions, high level of PflB should direct pyruvate to formate synthesis and therefore hydrogen production.

tdcE

The tdcE gene encodes the second pyruvate formate lyase [2]. The reasons to overexpress this gene are the same as for pflB.

Materials and methods

To over-express these three genes of interest, we decided to insert them into plasmid pSB1C3 with a strong RBS, a constitutive promoter and a terminator. We decided to work in the BioBrick standard assembly 10 because it is compatible with pSB1C3.
First of all, we had to obtain the three genes to ligate them with the RBS, the promoter and the terminator. Unfortunately, the fnr gene contains an EcoR1 restriction site. Therefore, we had to introduce a silent mutation in the sequence of this restriction site and ordered the modified fnr on mrgene.com.
The tdcE gene was obtained by PCR using specific primers and the wild-type genome of E. coli.
The pflB sequence contains a restriction enzyme present in the standard assembly 10: Pst1. We could have also introduced a silent mutation in this sequence and ordered it on mrgene.com. However, due to the size of the pflb gene (2283 bp) and our limited budget, we were not able to afford it.
The RBS, the promoter and the terminator that were selected are the same for the three genes and are described as being the ‘strongest’ ones received in spring 2010 distribution.
The promoter is: BBa_J23100
The RBS is: BBa_B0034
The terminator is: BBa_B0024
After obtaining the gene sequences either by PCR or by in vitro synthesis, the plan was to ligated them into the plasmid containing the RBS opened with Spe1 and Pst1 in order to clone the genes downstream of the RBS. The genes were also digested by Xba1 and Pst1. The second step was to ligate the part RBS + gene with the promoter. The third step consisted in extracting the construction promoter + RBS + gene and inserting upstream of the terminator. The last step was to extract the promoter+RBS+gene+terminator and insert it into the pSB1C3 plasmid.
Unfortunately, due to lack of time, we were unable to do all these constructs.
We managed to obtain the gene tdcE by PCR as we can see here:

The gene tdcE is in the sink 3 and 5. The two sinks correspond to two different PCR programs. The sinks 2 and 4 are the negative controls for those PCR.
We digested tdcE and inserted it in the pSB1C3 to send it as a BioBrick: BBa_K348000.

Genes of the MAF pathway that we did not consider

Several other genes of the MAF pathway could have been potential candidates for modifications (deletion or overexpression). However, after exhaustive literature readings, we did not consider them.

hycA

This gene encodes HycA, a regulator of the hydrogenase 3 in the FHL system [2]. This regulator limits the amount of hydrogenase 3 in the cell. Deleting hycA should therefore lead to an increase of the concentration of hydrogenase 3. Note that as stated above, the hydrogenase 3 catalyzes the transformation of formate into hydrogen. We did not consider this candidate since transformation of formate into hydrogen do not appear to be the limiting step for hydrogen production and normal concentration of hydrogenase 3 is fully adequate[3].

aceE

This gene encodes a subunit of the pyruvate dehydrogenase complex. This complex catalyzes the following reaction [2]:
Pyruvate + NAD+ + coenzyme A <=> Acetyl-CoA + CO2 + NADH
For hydrogen production, transformation of pyruvate into formate is needed. The AceE enzyme catalyzes a variety of reactions, and deleting the corresponding gene reduces E. coli viability [1]. We therefore decided not to delete this gene. We focused on the transformation of pyruvate into formate and to overexpress the tdcE gene (see above).

poxB

The poxB gene encodes a pyruvate oxydase, which catalyzes the transformation of pyruvate into acetate and CO2 [1]. It has been described that deleting poxB does not increase hydrogen production [1].

focB

FocB is a formate transporter (the other formate transporter is FocA, see above). Unlike FocA, FocB is less efficient and less specific to formate. We could have deleted focB as well but deleting the two formate transporter would have reduced the growth rate[1].

fdoG and fdnG

fdoG encodes the formate dehydrogenase-O and fdnG the formate dehydrogenase-N. Those two formate dehydrogenase catalyze the transformation of formate into CO2 + H+. The formate dehydrogenase-O is active under aerobic conditions. We can therefore avoid deleting fdoG simply because our bacteria will be used under anaerobic conditions. The formate dehydrogenase-N needs a source of nitrate to be active. In the laboratory, it is easy to work on a medium which does not contain nitrogen and we can avoid deleting this gene. In reality, in a sewage treatment facility, this could be much more problematic. We can propose that our bacteria will be used to produce hydrogen after the nitrogen removal step. Deleting fdnG would be necessary if we want to produce hydrogen in a medium that contains nitrogen. Moreover, the formate dehydrogenase-N is a much more effective enzyme than the FHL system. Most of the formate will thus be consumed by the formate dehydrogenase-N instead of being transformed into hydrogen.

Table 1

All the sequences are listed in the directionality 5' -> 3'.
PPC
H1R1: ACCCTCGCGCAAAAGCACGAGGGTTTGCAGAAGAGGAAGAGTGTAGGCTGGAGCTGCTTC
H2R2: ACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAATCATATGAATATCCTCCTTA
LdhA
H1R1: ATCTGAATCAGCTCCCCTGGAATGCAGGGGAGCGGCAAGAGTGTAGGCTGGAGCTGCTTC
H2R2: AGTAGCTTAAATGTGATTCAACATCACTGGAGAAAGTCTTCATATGAATATCCTCCTTA
FocA
For FocA, we didn't try to delete the entire gene because FocA is located next to pflB (one of the genes useful for hydrogen production, see above). The RBS and the promoter of pflB are included into the sequence of FocA. We decided to remove only the half of FocA, leaving the RBS and promoter of pflB untouched.
H1R1: GCTGCGGCCAGAATAACTCATCCATACTGCCAGACATACCGTGTAGGCTGGAGCTGCTTC
H2R2: GTTAGTATCTCGTCGCCGACTTAATAAAGAGAGAGTTAGTCATATGAATATCCTCCTTA
HyaB
H1R1: CAGAAACCGAACATCAGCCAGGCAATGAGGATAAACAGGCGTGTAGGCTGGAGCTGCTTC
H2R2: CGTTGTCGCTTTTCTGTTGCATGATGATTCTCCTTCGCTGCATATGAATATCCTCCTTA
HybC
H1R1: GTCAGCAAAATATTGCCGACCCCTAAGACTAAAATACGCAGTGTAGGCTGGAGCTGCTTC
H2R2: TAAAACAAAACGATCATAATCGTCATGAGGCGAGCAAAGCCATATGAATATCCTCCTTA

References

[1] Maeda, T.; Sanchez-Torres, V.; K. Wood, Thomas. - Enhanced hydrogen production from glucose by metabolically engineered Escherichia coli - Appl Microbiol Biotechnol (2007) 77:879–890 – September 2007.
[2] The database Ecocyc for the bacterium Escherichia coli K-12 MG1655, consulted online in July, August and September 2010: http://ecocyc.org/
[3] Node, K.; Watanabe, M.; Makimoto, H.; Tomiyama, M. - Effect of hydrogenase 3 over-expression and disruption of nitrate reductase on fermamentive hydrogen production in Escherichia coli

[4] The KEIO Collection consulted online in July, August and September 2010: http://ecoli.naist.jp/gb6/Resources/deletion/deletion.html

[5] Suppmann, B.; Sawers, G. - Isolation and characterization of hypophosphite--resistant mutants of Escherichia coli: identification of the FocA protein, encoded by the pfl operon, as a putative formate transporter - Lehrstuhl für Mikrobiologie der Universität München, Germany. - Mol Microbiol. 1994 Mar;11(5):965-982. – March 1994.

[6] Sawers, R.G. - Formate and its role in hydrogen production in Escherichia coli - Biochemical Society Transactions (2005) Volume 33, part 1 – Pages 42-46 – September 2004.

Introduction

Homologous recombination

@@ Line 19: / Line 19: @@
 <p><br>
-E. coli naturally produces hydrogen through the  mixed acid fermentation. Our goal in this part of the project is to increase  the H2 production by modifying the carbon  flow through the pathways of the mixed acid fermentation (MAF). The pathways of  this fermentation are quite simple. Phosphoenolpyruvate (PEP), which comes from  the glucolysis, is transformed into pyruvate or into oxaloacetate. Those two  molecules are then transformed into several products after a chain of  reactions. Hydrogen is one of those products. It is produced from formate to  regulate the intracellular pH of the bacteria <a href="#R1">[1]</a>.</p>
+<em>E. coli</em> naturally produces hydrogen through the mixed  acid fermentation. Our goal in this part of the project is to increase the H2  production by modifying the carbon flow through the pathway of the mixed acid  fermentation (MAF). The pathways of this fermentation are quite simple.  Phosphoenolpyruvate (PEP), which is produced by the glycolysis, is transformed  into pyruvate or into oxaloacetate. Those two molecules are then transformed  into several products after a chain of reactions. Hydrogen is one of those  products. It is produced from formate to regulate the intracellular pH of the  bacteria <a href="#R1">[1]</a>.</p>
-<p>Here is a simplified global overview  of the mixed acid fermentation (see fig.1 below):<br>
+<p>Here is a simplified global overview  of the mixed acid fermentation (fig.1):<br>
 </p>
 <div align="center"><table border="0" align="center">
@@ Line 31: / Line 31: @@
 </table></div>
-<p> Each reaction is controlled by one or several enzymes.  By overexpressing or deleting specific genes involved in the MAF, we expect to  increase the production of hydrogen. The pathway in which we are interested in is this one (see fig. 2 below):</p>
+<p> EEach reaction is controlled by  one or several enzymes. By overexpressing or deleting specific genes of the MAF  pathway, we expect to increase the hydrogen production. The part of MAF pathway in which we are  interested is indicated by red lines (fig. 2).</p>
 <div align="center"><table border="0" align="center">
    <tr>
@@ Line 40: / Line 40: @@
    </tr>
 </table></div>
-<p>        All  the reactions crossing the red lines should be avoided or limited, and the  three main reactions which lead to the production of hydrogen should be  increased.<br>
+<p>        All the reactions crossing the red lines should be avoided or limited, and the three main reactions which lead to hydrogen production should be increased.
-  The hydrogen is produce from formate by the  formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex  composed of the formate dehydrogenase (FDHH) and the hydrogenase 3  [1]. This complex catalyzes the reaction:<br>
+The hydrogen is produced from formate by the formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex composed of the formate dehydrogenase (FDHH) and the hydrogenase 3
-  Formate + H+ &lt;=&gt; H2 + CO2<br>
+<a href="#R1">[1]</a>. This complex catalyzes the following reaction:</p>
-  Hydrogen is not excreted outside the bacteria  but it is immediately consumed by two uptake hydrogenases, the hydrogenase 1  and 2 following this reaction [1][2]:<br>
+<p align="center"><br>
-   A menaquinone  + H2 + 2H+ &lt;=&gt; A menaquinol + 2H+<br>
+Formate + H+ &lt;=&gt; H2 + CO2</p>
-The FHL system is activated by FhlA (formate  hydrogen-lyase transcriptional activator), which is regulated by FNR and  repressed by HycA [1]. FNR is the main transcriptional regulator that mediates  the transition between aerobic and anaerobic growth through the regulations of  hundreds of genes [2]. All the regulations linked to the transformation of  formate into hydrogen are shown here (see fig.3  below):</p>
+<p><br>
+Hydrogen is not excreted outside of the cell but  it is immediately consumed by two uptake hydrogenases, the hydrogenase 1 and 2  <a href="#R1">[1]</a><a href="#R2">[2]</a>:</p>
+<p align="center"><br>
+   A menaquinone  + H2 + 2H+ &lt;=&gt; A menaquinol + 2H+</p>
+<p><br>
+The expression of the FHL system is activated at  the level of transcription by the FhlA activator (formate hydrogen-lyase  transcriptional activator). Expression of <em>fhlA</em> is positively regulated by FNR and repressed by HycA <a href="#R1">[1]</a>. FNR is the main  transcriptional regulator that mediates the transition between aerobic and  anaerobic growth through the regulation of hundreds of genes <a href="#R2">[2]</a>. All the  regulations linked to the transformation of formate into hydrogen are shown  here (fig.3):</p>
 <p><br>
 </p>
@@ Line 57: / Line 62: @@
 <p>&nbsp;</p>
 <p><br>
-   <gh2>Genes to delete</gh2>
+   <gh2>MAF pathway modification: genes to delete</gh2>
 </p>
 <p><br>
-   Several reactions in the MAF are irrelevant to  hydrogen production (see figure 2 above). To  disable these reactions we have to delete the genes which code for the enzymes  catalyzing those reactions. <br>
+   Several steps of the MAF pathway are irrelevant for hydrogen production (fig. 2). To inactivate these reactions, the genes encoding enzymes that catalyze these reactions have to be deleted using the technique described in the homologous recombination module.
-  We studied a lot of articles about producing H2  through the MAF. Based on that, we decided which genes we would overexpress and  which we would disrupt. <br>
+After exhaustive analyzes of the literature, we decided which genes we would overexpress and which we would disrupt.
-Here is the list of all the genes that we  planned to delete. By using the KEIO Collection database, we checked that none  of those genes were essential to the bacteria <a href="#R4">[4]</a>.</p>
+Here is the list of all the genes that we planned to delete. By using the KEIO Collection database, we checked that none of those genes were essential
+ <a href="#R4">[4]</a>.</p>
 <ol start="1" type="1">
-   <li><strong>PPC</strong><strong> </strong></li>
+   <li><strong>ppc</strong><strong> </strong></li>
 </ol>
-<p>The gene ppc codes for the phosphoenolpyruvate  carboxylase (Ppc). This enzyme catalyzes the reaction <a href="#R2">[2]</a>:<br>
+<p>The <em>ppc</em> gene encodes the phosphoenolpyruvate carboxylase enzyme (Ppc). This enzyme  catalyzes the following reaction  <a href="#R2">[2]</a>:</p>
-   Phosphoenolpyruvate + CO2 + H2O &lt;=&gt; Oxaloacetate  + Phosphate + H+<br>
+<p align="center"><br>
-  Deleting ppc will therefore prevent the PEP  being transformed into oxaloacetate which is not interesting for us. As shown  on figures 1 and 2, the left wing of the mixed acid fermentation does not lead  to hydrogen production. This wing starts with the transformation of PEP into oxaloacetate.  The deletion of ppc will therefore disable this pathway and all the PEP will be  transformed into pyruvate.</p>
+   Phosphoenolpyruvate + CO2 + H2O &lt;=&gt; Oxaloacetate  + Phosphate + H+</p>
+<p><br>
+Deletion of the <em>ppc</em> gene will therefore prevent the PEP to be transformed into  oxaloacetate which is not interesting for our application. As shown on figures  1 and 2, the left part of the MAF pathway does not lead to hydrogen production.  Thus, deletion of <em>ppc</em> will inactivate  this part of the pathway and all the PEP will be transformed into pyruvate.</p>
 <ul>
-   <li><strong>LdhA</strong></li>
+   <li><strong>ldhA</strong></li>
 </ul>
-<p align="left">Pyruvate is transformed into  (R)-lactate or into formate + acetyl-CoA but only this second reaction is  interesting for us. We must therefore disable the first one. LdhA is the gene  coding for the D-lactate dehydrogenase which catalyze the following reaction:<br>
+<p align="center">Pyruvate is transformed into  (R)-lactate or into formate + acetyl-CoA. The second reaction is interesting  for our application. The first reaction is mediated by the D-lactate  dehydrogenase (LdhA) which catalyzes the following reaction:</p>
-   NADH + Pyruvate + H+ &lt;=&gt; NAD+ + (R)-lactate<br>
+<p align="center"><br>
-  Deleting ldha should ensure  that all the pyruvate should be transformed into formate + acetyl-CoA.</p>
+   NADH + Pyruvate + H+ &lt;=&gt; NAD+ + (R)-lactate</p>
+<p align="center"><br>
+Deletion of <em>ldhA</em> should ensure that all the pyruvate is transformed into formate + acetyl-CoA.</p>
 <ul>
-   <li><strong>FocA</strong></li>
+   <li><strong>focA</strong></li>
 </ul>
-<p>FocA codes for a formate transporter of the plasmic  membrane which excreted formate outside the cell. It has been shown that  disabling this transporter increase the intracellular concentration of formate  <a href="#R5">[5]</a>. Higher formate concentration inside the cell is obviously interesting for  hydrogen production.</p>
+<p>The <em>focA</em> gene encodes for a formate transporter located in the plasmic membrane. FocA  transports formate outside the cell. It has been shown that disabling this transporter  increases the intracellular formate concentration   <a href="#R5">[5]</a>. A higher formate intracellular concentration is  obviously interesting for hydrogen production.</p>
 <ul>
-   <li><strong>HyaB</strong></li>
+   <li><strong>hyaB and hybC</strong> </li>
 </ul>
-<p>To prevent hydrogen uptake by the two  hydrogenases, HyaB and HybC, we have to disable them. Both hydrogenases are  coded by an operon. The HyaB operon is composed of 6 genes (from HyaA to HyaF),  hyaB coding for the largest subunit of the hydrogenase [2]. This subunit is  required for the hydrogenase to be functional<a href="#R2"> [2]</a>. Deleting this subunit should  disable the hydrogenase 1 <a href="#R1">[1]</a>.</p>
+<p>To prevent hydrogen uptake by the two hydrogenases, HyaB and HybC, we have to inactivate them. Both hydrogenases-encoding genes are located in operons.
-<ul>
+The hya operon is composed of 6 genes (from hyaA to hyaF). The hyaB gene encodes the largest subunit of the hydrogenase <a href="#R2"> [2]</a>. This subunit is  required for the hydrogenase to be functional<a href="#R2"> [2]</a>. Deleting this gene should inactivate the hydrogenase 1 <a href="#R1">[1]</a>.</p>
-  <li><strong>HybC</strong></li>
+<p>The second hydrogenase-encoding gene is located in an operon composed of 7 genes (from hybA to hybG). The hybC gene encodes the largest subunit of the second hydrogenase. As for hyaB, deleting the gene encoding the largest subunit should inactivate it  <a href="#R1">[1]</a>.</p>
-</ul>
-<p>The second hydrogenase is coded by an operon of  7 genes (from HybA to HybG), HybC coding for the largest subunit of the second  hydrogenase. As for HyaB, deleting the largest subunit of the hydrogenase  should disable it <a href="#R1">[1]</a>.</p>
 <p>&nbsp;</p>
 <p><gh2>Materials and methods</gh2>
 </p>
-<p><br>
+<p>&nbsp;</p>
-   In order to delete  the five genes listed above, we used a method based on the λ phage Red  recombinase (see chapter X). It consists in  producing a gene-specific PCR fragments, containing an antibiotic resistance  gene. The targeted gene is replaced by the resistance gene through homologous  recombination performed by the Red recombinase system, and finally the  resistance is removed.All the primers used for the  deletions of the 5 genes are listed in Table 1 at the end of this chapter.<br>
+<ol>
-  Both  chloramphenicol and kanamicine resistance cassette already contain the FRT  sequence required to remove the resistance after a successful deletion (see chapter X about the homologous recombination) <br>
+   <li><u>Gene  deletion by the λ phage Red system</u></li>
-  The antibiotic  resistance will help us to select the bacteria in which the targeted gene has  been successfully disrupted. To delete a gene, we simply had to electroporate  the cells with the PCR product   and then  spread them on a selective medium containing the appropriate antiobiotic. In  order to achieve the deletion by homologous recombination, the cells must be  transformed with the plasmid helper λ (PH λ). We had to streak three times the  deletion candidates on agar plate with the appropriate antibiotic, in order to  purify their genome. A bacteria has numerous copies of each of its genes. The  streaking process on a selective medium has for objective to eliminate the wild  type version of the surnumerous chromosomes. After this process, we tested our  deletion candidate by PCR. We amplified the area of the deletion and by  measuring the obtained sequence (by electrophoresis), we were able to verify if  the expected deletion has happened or not. If the sequence amplified has the  length of the wild type, the deletion failed, but if the sequence has the  length of the resistance cassette, the gene has been successfully deleted.<br>
-   The next step is to  remove the resistance cassette using the flippase recombination enzyme (see chapter X about homologous recombination). The  flippase will recognize the FRT (flippase recognition target) sequence placed  at each ends of the resistance cassette and will delete what is in between the  two FRT sequences. Once the cassette has been removed, we a single deletion  mutant. We can start the deletion process from the start for another gene to  obtain a two deletion mutant. <br>
+<p>In order to delete  the five genes listed above, we used a method based on the λ phage Red system. As  this method is described in great details in the &lsquo;homologous recombination  module&rsquo;, we will briefly summarize it here. This method consists in the  production of a gene-specific PCR fragment which contains an antibiotic  resistance gene and site-specific recombination sites (FRT) flanking this gene.  This PCR fragment is then electroporated in a strain containing the plasmid  helper λ (PH λ) (see homologous recombination module). This plasmid encodes the  genes of the Red system. The target gene is replaced by the resistance gene  through homologous recombination using the Red system. We worked with two  different antibiotic resistances: chloramphenicol (cm) and kanamicine (kan).<br>
-To  avoid losing too much time, we proceeded to the different deletions in  parallel. The single gene mutations in the different resulting strains were  then combined using P1 transduction. That is the reason why we used two  different resistance cassettes (chloramphenicol and kanamicine). Once we have  two different strains of bacteria, each with one gene deleted and the  resistance cassette still in place, we can combined them using P1 transduction.  Two different resistance cassettes are needed in order to select the two  deletion mutant on a selective medium. The selective medium contains the two  antibiotics. </p>
+The antibiotic resistance  cassette is eventually removed by site-specific recombination using the Flp  recombinase. This method leads to the &lsquo;clean&rsquo; deletion of the gene of interest  without any traces of antibiotic resistance gene. It is also adapted to delete  genes in operons since the resistance-FRT cassettes used in this work also contain  translation signal (RBS). This allows a proper expression of the genes  downstream of the deletion (no polar effect). The  primers used deleting the 5 genes of interest are listed in Table 1.  </p>
+   <li><u>Phage P1  transduction</u></li>
+</ol>
+<p>P1vir stock&nbsp;:<br>
+  Overnight cultures of the donor strain are  diluted 100 fold in 20 ml of LB medium supplemented with MgSO4 10-2M  and of CaCl2 5.10-3M and grown at 37°C. At an optical density at  600nm of 0.2, 10µl of a P1 vir stock is added (approximately 109  pfu/ml). Once the bacteria are lysed, 1/20 (v/v) of chloroform is added and the  culture is vigorously shacked. The mix is centrifuged at 4°C at 3,700 g and the  supernatant is conserved at 4°C. 1/20 of the total volume of chloroform is  added and vigorously shacked, then centrifuged again in the same conditions.  The surnageant containing the P1 particles is stored at 4°C. <br>
+  P1vir  transduction :<br>
+  Overnight culture of the recipient strain is  pelleted and resuspended in the same volume of MgSO4 10-2M and of  CaCl2 5.10-3M. To 100µl of the resuspended pellet, 100µl and 10µl of  the P1 lysat is added. The mix is conserved 30 min at 37°C. 3 ml of agar 0.7%  is added as well as 100µl of Na citrate 1M. The entire mix is plated on  selective plates at 37°C for 16h. The candidates are streaked 3 times on  selective plates and a PCR is then performed to confirm the transduction of the  marker of interest.  </p>
+<p>&nbsp;</p>
 <p><br>
    <gh2>Results</gh2>
 </p>
+<p>&nbsp;</p>
+<ol>
+  <li><u>Deletion  of the <em>ldhA</em> gene by homologous  recombination</u></li>
+</ol>
 <p><br>
-   In  the laboratory, we only managed to obtain a three deletion mutant. The  construction of the resistance cassettes for each gene by PCR took us a little  more than a week. Because of the size of the primers used, we had to try  several times those PCR. Once we had our resistance cassettes, it took us about  1 month to obtain our first deletion candidate. The process of electroporation for  deletions is not really efficient. We obtained a lot of deletion candidate  (i.e. we obtained a lot of bacteria which grew on the selective medium). As  explained in the materials and methods part, we had to streak three times each  candidate (this process takes therefore 3 days). Unfortunately the candidates  often were negative: we assumed that the resistance cassette was inserted at a  wrong space in the genome, giving the bacteria the resistance but without  deleting the aimed gene. Once we had two different strains, each one with a  different resistance cassette for a different deleted gene, we were able to  start the transduction process. By the time we finally had our three deletion  mutant; it was too late for a measurement campaign.</p>
+   The amplification of the resistance cassettes with  the primers specific to our 5 genes of interest by PCR took us a little more  than a week. Because of the size of the primers used, we had to try several  times the PCR and vary the parameters. <br>
+Here is the picture of the electrophoresis of  those PCR for the 5 genes: </p>
+<table border="0" align="center">
+  <tr>
+    <td align="center"><p><img src="https://static.igem.org/mediawiki/2010/7/77/ULBH2_(1).png"><br>
+      <leg></leg>
+    </p></td>
+  </tr>
+</table>
+<p><gh2></gh2>
+  For each genes we tried to obtain both  chloramphenicol (about 1100bp) and kanamicine (about 1500bp) resistance  cassettes. From left to right we have the genes <em>ldhA</em> (1 and 2), <em>focA</em> (4  and 5), <em>ppc</em> (7 and 8), <em>hybC</em> (10 and 11) and <em>hyaB</em> (13 and 14). The sinks 3, 6, 9, 12  and 15 are the five negative controls.<br>
+        Once  we obtained these cassettes, it took us about 1 month to obtain our first  deletion candidate. The electroporation efficiency of the MG1655/PHl strain was not good. We obtained a lot of false-positive deletion  candidates (i.e. clones growing on the selective medium). As explained in the homologous  recombination module, we had to purify at least three times each candidate  (this process takes therefore at least 3 days) before checking the  deletion/insertion of the resistance cassette. Using primers complementary to  the flanking regions of the genes of interest, PCR were performed on candidate  colonies (data shown below). Unfortunately, the candidates were most of the time  wild-type for the gene of interest. Our hypothesis is that the resistance  cassette was inserted at another location in the genome. The reason for that is  unknown since the genes of interest are not essential for <em>E. coli</em> viability, at least in the conditions we used.  <br>
+After  several weeks of unsuccessful attempts, we finally obtained the MG1655 <em>D</em><em>ldhA::cm</em> strain.
+Here is the picture of the  electrophoresis where we tested different deletion candidates:</p>
+<table border="0" align="center">
+  <tr>
+    <td align="center"><p><img src="https://static.igem.org/mediawiki/2010/9/90/ULBH2_(2).png"><br>
+      <leg></leg>
+    </p></td>
+  </tr>
+</table>
+<p>The sinks we are interested in are the 4 first  ones. The wild type version of the gene <em>ldhA</em> is in the third sink. The two first sinks are the deletion candidates for <em>ldhA </em>with the cm resistance cassette<em>.</em> The fourth sink is the negative  control for this gene. For information, the other sinks are the tests for the 4  other genes: 5 and 6 are the deletion candidates for ppc; 9 and 10 are the  deletion candidates for focA; 17 and 18 are the deletion candidates for hybC:  21 and 22 are the deletion candidates for hyaB. Unfortunately, the cm  resistance cassette (about 1100 bp) and the gene <em>ldhA</em> (990 bp) have approximately the same length. In order to  testify if we really had the MG1655 <em>D</em><em>ldhA::cm</em> strain,  we did a test with a restriction enzyme which cut the gene <em>ldhA.</em> <br>
+The  result of this test is shown here:</p>
+<table border="0" align="center">
+  <tr>
+    <td align="center"><p><img src="https://static.igem.org/mediawiki/2010/2/28/ULBH2_(3).png"><br>
+      <leg></leg>
+    </p></td>
+  </tr>
+</table>
+<p>After the purification process, we had 4 candidates  for the MG1655 <em>DldhA::cm</em> strain. For those 4 candidates, we did a PCR on  the gene <em>ldhA </em>(not knowing if it  really was <em>ldhA</em> or the cm resistance  cassette that we amplified) and we digest the product of the PCR with an enzyme  which cut <em>ldhA.</em> The digested gene <em>ldhA</em> is in the sink 7, the digested cm  resistance cassette is in the sink 6. The four digested candidates are in the 4  first sinks. The result is therefore a success, because the candidates are not  digested like <em>ldhA</em>. The wild-type  version of the gene has been successfully replaced with the cm resistance  cassette. We have our MG1655 <em>DldhA::cm</em> strain.</p>
+<ul>
+  <li><u>Construction  of the MG1655</u><em><u> D</u></em><em><u>ppc::kan</u></em><u>, MG1655</u><em><u> D</u></em><em><u>focA::kan</u></em><u>, MG1655</u><em><u> D</u></em><em><u>hyaB::kan</u></em><u>, MG1655 </u><em><u>D</u></em><em><u>ldhA::cm</u></em><u> </u><em><u>D</u></em><em><u>ppc::kan</u></em><u>, MG1655 </u><em><u>D</u></em><em><u>ldhA::cm</u></em><em><u> D</u></em><em><u>focA::kan </u></em><u>andMG1655 </u><em><u>D</u></em><em><u>ldhA::cm</u></em><em><u> D</u></em><em><u>hyaB::kan</u></em><u> mutant strains by P1  transduction</u></li>
+</ul>
+<p>By  that time, we obtained the KEIO strains deleted for our 5 genes of interest. We  were thus able to make a P1 stock on these strains (see materials and methods)  and to transduce the <em>D</em><em>ppc::kan</em>, <em>D</em><em>focA::kan</em>, <em>D</em><em>hyaB::kan</em> and <em>D</em><em>hybC::kan</em> markers in the  MG1655 wild-type strain and in the MG1655 <em>D</em><em>ldhA::cm</em> strain.  We obtained 6 mutant strains: the single MG1655<em> D</em><em>ppc::kan</em>, MG1655<em> D</em><em>focA::kan</em> and MG1655<em> D</em><em>hyaB::kan</em> mutant strains as  well as the double MG1655 <em>D</em><em>ldhA::cm</em> <em>D</em><em>ppc::kan</em>, MG1655 <em>D</em><em>ldhA::cm</em><em> D</em><em>focA::kan </em>andMG1655 <em>D</em><em>ldhA::cm</em><em> D</em><em>hyaB::kan</em> mutant strains.  These strains were checked by PCR.  <br>
+  The results are shown here:</p>
+<table border="0" align="center">
+  <tr>
+    <td align="center"><p><img src="https://static.igem.org/mediawiki/2010/5/5e/ULBH2_(4).png"><br>
+      <leg></leg>
+    </p></td>
+  </tr>
+</table>
+<p>&nbsp;</p>
+<p>For  each strain tested, we have: four candidates, one negative control and the wild  type version of the gene that is supposed to have been deleted. If the  amplified DNA segment of a candidate has the size of the reistance cassette instead  of the size of the wild type version of the gene, the candidate is a mutant.  Here are the results:</p>
+<ul>
+  <li>From 1 to  6 is the test for the MG1655<em> D</em><em>hyaB::kan</em> mutant:  the 4 candidates are mutants. </li>
+  <li>From 8 to 13 is the test for the MG1655 <em>D</em><em>ldhA::kan </em>mutant: the  candidates in the sinks 10 and 11 are mutants.</li>
+  <li>From 17 to 22 is the test for the gene <em>ldhA</em> of the double MG1655 <em>D</em><em>ldhA::cm</em> <em>D</em><em>ppc::kan </em>mutant: the 4  candidates are mutants.</li>
+  <li>From 24 to 29 is the test for the gene <em>ldhA</em> of the double MG1655 <em>D</em><em>ldhA::cm</em><em> D</em><em>focA::kan </em>mutant:  the 4 candidates are mutants.</li>
+  <li>From 33 to 38 is the test for the gene focA of the  double MG1655 <em>D</em><em>ldhA::cm</em><em> D</em><em>focA::kan </em>mutant:  the candidates in the sinks 35 and 36 are mutants.</li>
+  <li>From 40 to 45 is the test for the gene <em>ppc</em> of the double MG1655 <em>D</em><em>ldhA::cm</em> <em>D</em><em>ppc::kan </em>mutant: the  candidates in the sinks 40, 42 and 43 are mutants.</li>
+</ul>
+<p>        We  managed to obtain different double mutant strains, ready for another  transduction. Unfortunately, due to the lack of time we were unable to continue  our progression and we were also unable to characterize the double mutant strains for  growth in different medium, at different temperature, …</p>
 <p>&nbsp;</p>
-<p><gh2>Genes  to overexpress</gh2>
-</p>
 <p><br>
-   In order to enhance  hydrogen production, we decided to over-express some genes involved in the  hydrogen production. In the mixed acid fermentation, there are three reactions  which interest us: </p>
+   <gh2>MAF pathway modification: Genes to overexpress</gh2>
+</p>
+<p>
+<p>In order to enhance  hydrogen production, we proposed to over-express some genes involved in the  hydrogen production. Three steps in the mixed acid fermentation pathway are of  interest:
 <ul>
    <li>The  transformation of phosphoenolpyruvate into pyruvate:</li>
 </ul>
-<p>Phosphoenolpyruvate + ADP + 2H+ &lt;=&gt; Pyruvate + ATP<br>
+<p align="center">Phosphoenolpyruvate + ADP + 2H+ &lt;=&gt; Pyruvate + ATP <br></p><p>
-   This reaction happens in  other pathways, so we decided not to improve it assuming it won’t be the limiting  reaction.</p>
+   This reaction is present in  other pathway. We thus decided not to improve it assuming it will not be the  limiting step.</p>
 <ul>
    <li>The  transformation of pyruvate into formate:</li>
 </ul>
-<p>Pyruvate + Coenzyme A &lt;=&gt; Formate + Acetyl-CoA<br>
+<p align="center">Pyruvate + Coenzyme A  &lt;=&gt;  Formate + Acetyl-CoA <br></p><p>
-   This reaction is catalyzed  by two pyruvate formate lyase: pflB and tdcE. The formate is the key molecule  for hydrogen production and high levels of formate concentration inside the  cell are needed for hydrogen production <a href="#R6">[6]</a>. </p>
+   This reaction is catalyzed  by two pyruvate formate lyase: PflB and TdcE. The formate is the key molecule  for hydrogen production and intracellular elevated formate concentration is  needed for an efficient hydrogen production <a href="#R6">[6]</a>. </p>
 <ul>
    <li>The  transformation of formate into hydrogen:</li>
 </ul>
-<p>Formate + H+ &lt;=&gt; CO2 + H2<br>
+<p align="center">Formate + H+  &lt;=&gt;  CO2 + H2 <br></p>
-   This reaction is under the  control of the FHL complex (formate hydrogenase lyase). As explained earlier,  the FHL complex is regulated by FNR, a transcriptional regulator that mediates  the transition between aerobic and anaerobic growth, and repressed by HyaC. In  studies, we find that the activity of the FHL complex is not the limiting  process for hydrogen production. We, therefore, choosed not to over-express the  two enzymes of the FHL complex: the formate dehydrogenase (FDHH) and  the hydrogenase 3<a href="#R2">[2]</a>.<br>
+   <p>This reaction is under the  control of the FHL complex (formate hydrogenase lyase composed of the formate dehydrogenase  (FDHH) and the hydrogenase 3). As stated above, the FHL complex is  regulated by FNR, a transcriptional regulator that mediates the transition  between aerobic and anaerobic growth, and repressed by HyaC. It has been showed  that FHL activity is not the limiting step for hydrogen production. We decided  not to over-express the two enzymes of the FHL complex <a href="#R3">[3]</a>.<br>
-   On the basis of those three  reactions, we decided to overexpress the following genes:</p>
+   On the basis of these three  reactions, we decided to overexpress the following genes:</p>
 <ul>
-   <li><strong>FNR</strong></li>
+   <li><strong><em>fnr</em></strong></li>
 </ul>
-<p>        FNR is quite an obvious choice  for the first gene to overexpress. FNR is the main transcriptional regulator  that mediates the transition from aerobic to anaerobic growth <a href="#R2">[2]</a>. The  concentration of the protein FNR is the same under aerobic and anaerobic  conditions, but in presence of O2 the protein FNR is inactivated.  Under anaerobic conditions, the protein became functional and activates  hundreds of genes involved in anaerobic metabolism. FNR also represses genes  involved in aerobic metabolism <a href="#R2">[2]</a>. Over-expressing the gene FNR should  increase the concentration level of the protein FNR and should thus enhance all  the anaerobic metabolism of the bacteria. The three reactions of the mixed acid  fermentation leading to hydrogen will therefore be increased.</p>
+<p>        <em>fnr</em> is quite an obvious choice for the first gene to overexpress.  FNR is the main transcriptional regulator that mediates the transition from  aerobic to anaerobic growth <a href="#R2">[2]</a>. The concentration of the FNR protein is similar  under aerobic and anaerobic conditions. The regulation occurs at the level of FNR  activity: in the presence of O2, FNR is inactivated. Under anaerobic  conditions, FNR is functional and activates expression of hundreds of genes  involved in anaerobic metabolism. In these conditions, FNR represses genes  involved in aerobic metabolism <a href="#R2">[2]</a>. Over-expressing the <em>fnr</em> gene should increase FNR concentration and should thus enhance  the anaerobic metabolism. The three reactions of the mixed acid fermentation pathway  leading to hydrogen described above should therefore be increased.</p>
 <ul>
-   <li><strong>PflB</strong></li>
+   <li><strong><em>pflB</em></strong></li>
 </ul>
-<p>        PflB codes for one of the  two pyruvate formate lyases which catalyze the transformation of pyruvate into  formate  <a href="#R2">[2]</a>. This reaction is the most important one for hydrogen production.  Overexpressing PflB should assure sufficient concentration levels of formate  inside the cell for hydrogen production. The pyruvate is also used in many  other reactions, but we want the maximum of pyruvate to be used for hydrogen  production.</p>
+<p>        The <em>pflB</em> gene encodes one of the two pyruvate formate lyases which  catalyze the transformation of pyruvate into formate <a href="#R2">[2]</a>. This reaction is the  most important one for hydrogen production. Over-expressing <em>pflB</em> should increase formate concentration  and therefore hydrogen production. Although pyruvate is the substrate for many  other reactions, high level of PflB should direct pyruvate to formate synthesis  and therefore hydrogen production.</p>
 <ul>
-   <li><strong>TdcE</strong></li>
+   <li><strong><em>tdcE</em></strong></li>
 </ul>
-<p>        TdcE codes for the second  pyruvate formate lyase  <a href="#R2">[2]</a>. The reasons to overexpress this gene are the same  as for PflB.</p>
+<p>The <em>tdcE</em> gene encodes the second pyruvate formate lyase <a href="#R2">[2]</a>. The reasons to overexpress  this gene are the same as for <em>pflB</em>.</p>
-<p>&nbsp;</p>
+<p><strong><u>Materials  and methods</u></strong></p>
-<p><gh2>Materials  and methods</gh2>
-</p>
 <p><br>
-   To over-express those three  genes, we decide to insert them into to plasmid pSB1C3 with a strong RBS, a  constitutive promoter and a terminator. First of all, we had to obtain the  three genes in order to link them with the RBS, the promoter and the terminator.  We decided to work in the BioBrick standard assembly 10 because the plasmid  pSB1C3 is only compatible with this one. Unfortunately, FNR is cut by EcoR1,  and cannot be used without modifying its sequence. We introduce a silent  mutation in the restriction site of EcoR1 and we ordered our modified gene of  FNR on mrgene.com. TdcE was obtained by PCR using primers of the gene on the  wild type genome of E. coli. PflB is also cut by a restriction enzyme of the  standard assembly 10: Pst1. We could have also introduced a silent mutation in  this gene and order it on mrgene.com, but due to the length of Pflb (2283 bp)  and our limited budget, we were not able to afford it.<br>
+   To over-express these three  genes of interest, we decided to insert them into plasmid pSB1C3 with a strong  RBS, a constitutive promoter and a terminator. We decided to work in the  BioBrick standard assembly 10 because it is compatible with pSB1C3.  <br>
-   The RBS, the promoter and  the terminator chosen are the strongest ones received in spring 2010  distribution.<br>
+  First of all, we had to  obtain the three genes to ligate them with the RBS, the promoter and the  terminator. Unfortunately, the <em>fnr</em> gene contains an EcoR1 restriction site. Therefore, we had to introduce a  silent mutation in the sequence of this restriction site and ordered the  modified <em>fnr</em> on mrgene.com. <br>
+  The <em>tdcE</em> gene was obtained by PCR using specific primers and the wild-type  genome of <em>E. coli</em>. <br>
+  The <em>pflB</em> sequence contains a restriction enzyme present in the standard  assembly 10: Pst1. We could have also introduced a silent mutation in this sequence  and ordered it on mrgene.com. However, due to the size of the <em>pflb</em> gene (2283 bp) and our limited  budget, we were not able to afford it.<br>
+   The RBS, the promoter and  the terminator that were selected are the same for the three genes and are  described as being the &lsquo;strongest&rsquo; ones received in spring 2010 distribution.<br>
    The promoter is: BBa_J23100 <br>
    The RBS is: BBa_B0034<br>
    The terminator is: BBa_B0024<br>
-   When we had the genes, we  linked them to the RBS by digesting the plasmid of the RBS using the enzyme  Spe1 and Pst1 (in order to open the plasmid behind the RBS sequence). The genes  were digested by Xba1 and Pst1. Then we linked the two parts together using  ligation enzymes. We started this process again to insert the part RBS+gene  with the promoter. The next step consists in extracting the construction promoter+RBS+gene  and inserting it in front of the terminator. Finally, we have to extract the  construction promoter+RBS+gene+terminator and insert it into the pSB1C3. <br>
+   After obtaining the gene  sequences either by PCR or by <em>in vitro</em> synthesis, the plan was to ligated them into the plasmid containing the RBS  opened with Spe1 and Pst1 in order to clone the genes downstream of the RBS.  The genes were also digested by Xba1 and Pst1. The second step was to ligate  the part RBS + gene with the promoter. The third step consisted in extracting  the construction promoter + RBS + gene and inserting upstream of the  terminator. The last step was to extract the promoter+RBS+gene+terminator and  insert it into the pSB1C3 plasmid. <br>
-Unfortunately, we did not  have had the time the complete the all process. We only managed to link the  gene to the RBS. </p>
+  Unfortunately, due to lack  of time, we were unable to do all these constructs.<br>
-<p>&nbsp;</p>
+  We managed to obtain the  gene <em>tdcE</em> by PCR as we can see here:</p>
+<table border="0" align="center">
+  <tr>
+    <td align="center"><p><img src="https://static.igem.org/mediawiki/2010/d/d1/ULBH2_(5).png"><br>
+      <leg></leg>
+    </p></td>
+  </tr>
+</table>
+<p>The gene <em>tdcE</em> is in the sink 3  and 5. The two sinks correspond to two different PCR programs. The sinks 2 and  4 are the negative controls for those PCR.<br>
+           We digested <em>tdcE</em> and inserted it in the pSB1C3 to  send it as a BioBrick: BBa_K348000.
 <p><br>
-   <gh2>Other  genes considered</gh2>
+   <gh2>Genes of the MAF pathway that we did not consider</gh2>
-</p>
+<p>
-<p>&nbsp;</p>
+<p>
-<p><br>
+<p>Several other genes of the MAF pathway could have been potential  candidates for modifications (deletion or overexpression). However, after  exhaustive literature readings, we did not consider them.
-  Several  other genes are involved in the MAF and are potential candidates for modifications  (deletion or overexpression). We listed below all the other genes considered  for modification:</p>
+<ol>
-<ul>
+   <li><strong><em>hycA</em></strong></li>
-   <li><strong>HycA</strong></li>
+</ol>
-</ul>
+<p>        This gene encodes HycA, a  regulator of the hydrogenase 3 in the FHL system <a href="#R2">[2]</a>. This regulator limits the  amount of hydrogenase 3 in the cell. Deleting <em>hycA</em> should therefore lead to an increase of the concentration of  hydrogenase 3. Note that as stated above, the hydrogenase 3 catalyzes the  transformation of formate into hydrogen. We did not consider this candidate  since transformation of formate into hydrogen do not appear to be the limiting  step for hydrogen production and normal concentration of hydrogenase 3 is fully  adequate<a href="#R3">[3]</a>. </p>
-<p>        This  gene codes for HycA, a regulator of the hydrogenase 3 in the FHL system  <a href="#R2">[2]</a>.  The regulator limits the amount of hydrogenase 3 in the cell. Deleting HycA  should therefore lead to an increase of the concentration of hydrogenase 3. And  as explained in the beginning of this chapter, the hydrogenase 3 catalyzes the  transformation of formate into hydrogen. But a study about the hydrogenase 3 has  shown that, the transformation of formate into hydrogen is not the limiting  step for hydrogen production and that normal concentration of hydrogenase 3 is  fully adequate <a href="#R2">[3]</a>. We decided not to delete this gene based on that  information on to focus on the limiting steps of hydrogen production.</p>
+<ol>
-<ul>
+   <li><strong><em>aceE</em></strong><strong></strong></li>
-   <li><strong>AceE</strong></li>
+</ol>
-</ul>
+<p>        This gene encodes a subunit  of the pyruvate dehydrogenase complex. This complex catalyzes the following  reaction <a href="#R2">[2]</a>:<br>
-<p>        This gene codes for a  subunit of the pyruvate dehydrogenase complex. This complex catalyzes the  following reaction <a href="#R2">[2]</a>:<br>
    Pyruvate + NAD+ +  coenzyme A &lt;=&gt; Acetyl-CoA + CO2 + NADH<br>
-   Or what we want for  hydrogen production is the transformation of pyruvate into formate.  Unfortunately, AceE catalyzes other reactions, and deleting it reduces the  survivability and the growth rate of E. coli  <a href="#R1">[1]</a>. We therefore decided not to  delete this gene. This decision led us to focus on the transformation of  pyruvate into formate. That’s another reason why we decided to overexpress the  gene TdcE (see above).</p>
+   For hydrogen production,  transformation of pyruvate into formate is needed. The AceE enzyme catalyzes a  variety of reactions, and deleting the corresponding gene reduces <em>E. coli</em> viability <a href="#R1">[1]</a>. We therefore  decided not to delete this gene. We focused on the transformation of pyruvate  into formate and to overexpress the <em>tdcE</em> gene (see above).</p>
-<ul>
+<ol>
-   <li><strong>PoxB</strong></li>
+   <li><strong><em>poxB</em></strong></li>
-</ul>
+</ol>
-<p>        PoxB is coding for a  pyruvate oxydase, which catalyze the transformation of pyruvate into acetate  and CO2  <a href="#R1">[1]</a>. This reaction consumes pyruvate which is the opposite  of what we want. We could have deleted poxB but we did not because the  transformation of pyruvate into acetate and CO2 is a very slow  reaction <a href="#R2">[2]</a>. The pyruvate oxydase pathway is even less important under  anaerobic conditions <a href="#R2">[2]</a>. We also found, in a study, that deleting poxB did not  increased hydrogen production <a href="#R1">[1]</a>.</p>
+<p>        The <em>poxB</em> gene encodes a pyruvate oxydase, which catalyzes the  transformation of pyruvate into acetate and CO2 <a href="#R1">[1]</a>. It has been  described that deleting <em>poxB</em> does not  increase hydrogen production <a href="#R1">[1]</a>.</p>
-<ul>
+<ol>
-   <li><strong>FocB</strong></li>
+   <li><strong><em>focB</em></strong></li>
-</ul>
+</ol>
-<p>        FocB codes for another  formate transporter (the other formate transporter is focA, see above). Unlike  focA, focB is less efficient and less specific to formate. We could have  deleted focB aswell but deleting the two formate transporter would have reduced  the growth rate of our bacteria  <a href="#R1">[1]</a>. We, therefore, decided not to delete focB.</p>
+<p>        FocB is a formate  transporter (the other formate transporter is FocA, see above). Unlike FocA, FocB  is less efficient and less specific to formate. We could have deleted <em>focB</em> as well but deleting the two formate  transporter would have reduced the growth rate<a href="#R1">[1]</a>. </p>
-<ul>
+<ol>
-   <li><strong>FdoG and fdnG</strong></li>
+   <li><strong><em>fdoG</em></strong><strong> and <em>fdnG</em></strong></li>
-</ul>
+</ol>
-<p>        FdoG codes for formate  dehydrogenase-O and fdnG for the formate dehydrogenase-N. Those two formate  dehydrogenase catalyze the transformation of formate into CO2 + H+.  The formate dehydrogenase-O does it in presence of oxygen, in other words:  under aerobic conditions. We can therefore avoid deleting fdoG simply because  our bacteria will be used under anaerobic conditions. The formate  dehydrogenase-N needs a source of nitrate to be active. In the laboratory, it  is easy to work on medium which do not contain nitrogen and we can avoid  deleting this gene. In reality, in a sewage treatment, this is much more  problematic. But we can imagine that our bacteria will be used to produce  hydrogen after the step of nitrogen removal. Deleting fdnG is necessary if we  want to produce hydrogen in a medium which contain nitrogen. Especially when we  know that the formate dehydrogenase-N is a much more effective enzyme than the  FHL system. Most of the formate will thus consume by the formate dehydrogenase-N  instead of being transformed into hydrogen.</p>
+       <p> <em>fdoG</em> encodes the formate dehydrogenase-O  and <em>fdnG</em> the formate dehydrogenase-N.  Those two formate dehydrogenase catalyze the transformation of formate into CO2  + H+. The formate dehydrogenase-O is active under aerobic  conditions. We can therefore avoid deleting <em>fdoG</em> simply because our bacteria will be used under anaerobic conditions. The  formate dehydrogenase-N needs a source of nitrate to be active. In the  laboratory, it is easy to work on a medium which does not contain nitrogen and  we can avoid deleting this gene. In reality, in a sewage treatment facility,  this could be much more problematic. We can propose that our bacteria will be  used to produce hydrogen after the nitrogen removal step. Deleting <em>fdnG</em> would be necessary if we want to  produce hydrogen in a medium that contains nitrogen. Moreover, the formate  dehydrogenase-N is a much more effective enzyme than the FHL system. Most of  the formate will thus be consumed by the formate dehydrogenase-N instead of  being transformed into hydrogen.</p><p>&nbsp;</p>
-<p>&nbsp;</p>
+<p><gh2>Table  1</gh2><br><p>&nbsp;</p>
-<p><gh2>Table  1</gh2><br>
+   All the sequences are  listed in the directionality 5' -&gt; 3'.<br>
-   All the sequences are  listed in the directionality 5’ -&gt; 3’.<br>
    <strong><u>PPC</u></strong><br>
    H1<span style="background:yellow">R1</span>: ACCCTCGCGCAAAAGCACGAGGGTTTGCAGAAGAGGAAGA<span style="background:yellow">GTGTAGGCTGGAGCTGCTTC</span><br>
@@ Line 184: / Line 266: @@
    H2<span style="background:yellow">R2</span>: AGTAGCTTAAATGTGATTCAACATCACTGGAGAAAGTCTT<span style="background:yellow">CATATGAATATCCTCCTTA</span> <br>
    <strong><u>FocA</u></strong><br>
-   For FocA, we didn’t  try to delete the entire gene because FocA is located next to pflB (one of the  genes useful for hydrogen production, see above). The RBS and the promoter of  pflB are included into the sequence of FocA. We decided to remove only the half  of FocA, leaving the RBS and promoter of pflB untouched.<br>
+   For FocA, we didn't  try to delete the entire gene because FocA is located next to pflB (one of the  genes useful for hydrogen production, see above). The RBS and the promoter of  pflB are included into the sequence of FocA. We decided to remove only the half  of FocA, leaving the RBS and promoter of pflB untouched.<br>
    H1<span style="background:yellow">R1</span>: GCTGCGGCCAGAATAACTCATCCATACTGCCAGACATACC<span style="background:yellow">GTGTAGGCTGGAGCTGCTTC</span> <br>
    H2<span style="background:yellow">R2</span>: GTTAGTATCTCGTCGCCGACTTAATAAAGAGAGAGTTAGT<span style="background:yellow">CATATGAATATCCTCCTTA</span> <br>
@@ Line 192: / Line 274: @@
    <strong><u>HybC</u></strong><br>
    H1<span style="background:yellow">R1</span>: GTCAGCAAAATATTGCCGACCCCTAAGACTAAAATACGCA<span style="background:yellow">GTGTAGGCTGGAGCTGCTTC</span><br>
-  H2<span style="background:yellow">R2</span>: TAAAACAAAACGATCATAATCGTCATGAGGCGAGCAAAGC<span style="background:yellow">CATATGAATATCCTCCTTA</span> </p>
+H2<span style="background:yellow">R2</span>: TAAAACAAAACGATCATAATCGTCATGAGGCGAGCAAAGC<span style="background:yellow">CATATGAATATCCTCCTTA</span> </p>
 <p>&nbsp;</p>
-<p><gh2>References</gh2><br>
+<p><gh2>References</gh2><br><p>&nbsp;</p>
    [1]<a name="R1"></a> Maeda, T.; Sanchez-Torres, V.; K.  Wood, Thomas. - Enhanced hydrogen production from glucose by metabolically  engineered Escherichia coli - Appl Microbiol Biotechnol (2007) 77:879–890 –  September 2007.<br>
    [2]<a name="R2"></a> The  database Ecocyc for the bacterium <em>Escherichia coli</em> K-12 MG1655,  consulted online in July, August and September 2010: http://ecocyc.org/<br>