Team:Slovenia/METHODS and PARTS/notebook

From 2010.igem.org

(Difference between revisions)
 
Line 96: Line 96:
PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as &nbsp;templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.<br>
PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as &nbsp;templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.<br>
-
reverse for N-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(255, 255, 0);">TTA</span>GATGTTGTGGCGGATCTTG-3'
+
<p><span style="font-size: 75%;">reverse for N-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(255, 255, 0);">TTA</span>GATGTTGTGGCGGATCTTG-3'</span>&nbsp;</p>
-
forward for C-splits: 5'-ACTA<span style="background-color: rgb(255, 0, 0);">GAATTC</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(0, 255, 255);">TCTAGA</span><span style="background-color: rgb(255, 255, 0);">atg</span>GCCGACAAGCAGAAGAACG-3'
+
<p><span style="font-size: 75%;">forward for C-splits: 5'-ACTA<span style="background-color: rgb(255, 0, 0);">GAATTC</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(0, 255, 255);">TCTAGA</span><span style="background-color: rgb(255, 255, 0);">atg</span>GCCGACAAGCAGAAGAACG-3'</span>&nbsp;</p>
 +
<p><span style="font-size: 75%;">reverse for C-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(192, 192, 192);">GCTTCCCCCACTCCCACCGCCAGAGCCACC</span><span style="text-decoration: underline;">C</span></span><span style="font-size: 10px; line-height: 11px;">TTGTACAGCTCGTCCATGC-3'</span>&nbsp;</p>
 +
<p><span style="font-size: 75%; background-color: rgb(255, 0, 0);">EcoRI</span><span style="font-size: 75%;"> <span style="background-color: rgb(0, 255, 0);">NotI</span> <span style="background-color: rgb(0, 255, 255);">XbaI</span> <span style="background-color: rgb(255, 0, 255);">SpeI</span> <span style="background-color: rgb(128, 0, 128);">PstI</span> <span style="background-color: rgb(192, 192, 192);">linker</span></span></p>
-
reverse for C-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(192, 192, 192);">GCTTCCCCCACTCCCACCGCCAGAGCCACC</span><span style="text-decoration: underline;">C</span></span><span style="font-size: 10px; line-height: 11px;">TTGTACAGCTCGTCCATGC-3'
+
<p>&nbsp;</p>
-
<span style="background-color: rgb(255, 0, 0);">EcoRI</span><span style="font-size: 75%;"> <span style="background-color: rgb(0, 255, 0);">NotI</span> <span style="background-color: rgb(0, 255, 255);">XbaI</span> <span style="background-color: rgb(255, 0, 255);">SpeI</span> <span style="background-color: rgb(128, 0, 128);">PstI</span> <span style="background-color: rgb(192, 192, 192);">linker</span>
 
</div>
</div>

Latest revision as of 22:58, 27 October 2010

Fun fact:

notebook - split/FRET


week 1  week 11
week 2  week 12
week 3  week 13
week 4  week 14
week 5  week 15
week 6  week 16
week 7  week 17
week 8  week 18
week 9  week 19
week 10week 20


6/17/2010 – 6/20/2010
PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as  templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.

reverse for N-splits: 5'-TGTACTGCAGGCGGCCGCACTAGTTTAGATGTTGTGGCGGATCTTG-3' 

forward for C-splits: 5'-ACTAGAATTCGCGGCCGCTCTAGAatgGCCGACAAGCAGAAGAACG-3' 

reverse for C-splits: 5'-TGTACTGCAGGCGGCCGCACTAGTGCTTCCCCCACTCCCACCGCCAGAGCCACCCTTGTACAGCTCGTCCATGC-3' 

EcoRI NotI XbaI SpeI PstI linker