"

From 2010.igem.org

Revision as of 19:54, 27 October 2010 (view source) Nymuchang (Talk | contribs) (→Primers) ← Older edit		Revision as of 19:54, 27 October 2010 (view source) Nymuchang (Talk | contribs) (→Primers) Newer edit →
Line 28:		Line 28:
	= <font color=blue>Primers</font> =		= <font color=blue>Primers</font> =
-	Thhis is a list of all the primers we designed for	+	This is a list of all the primers we designed for
	== Speedy Reporter ==		== Speedy Reporter ==

---

Revision as of 19:54, 27 October 2010

Home

Project Overview

Speedy reporter

Speedy switch

Speedy protein degrader

Experiments and Parts

Applications

F.A.Q

About Us

---

Contents 1 Experiments 1.1 Protocols, preparation and other stuff 2 Parts 3 Primers 3.1 Speedy Reporter 3.2 Speedy Switch 3.3 Speedy Protein Degrader

Experiments

Lab notebooks (click the following links to see details):

• Speedy switch lab notebook
• Speedy reporter lab notebook
• Speedy protein degrader lab notebook

Experimental results:

• Speedy switch results: Several reporter gene assay results for testing the Theophylline riboswitch.
• Speedy degrader results: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.

Protocols, preparation and other stuff

• Basic cloning protocols. Optimised protocols developed and kept current over the past few years.
• Gene reporter assay protocols

• pSB1C3 preparation
• dddddH2O preparation (fun :P)

Parts

The range given to each group for this years' parts was divided as follows:

• Speedy Switch: K411000-K411099
• Speedy Reporter: K411100-K411199
• Speedy Protein degrader: K411200-K411299

The designed parts: <groupparts>iGEM010 NYMU-Taipei</groupparts>

Primers

This is a list of all the primers we designed for

Speedy Reporter

name	sequence	length	desc
eIF4A_split_A_Fp	cggcagcagcggcagcggcagcATGGAGCCGGAAGGCGTCATCGA	45
eIF4A_split_B_Rp	ctgcagcggccgctactagtaTCAAATGAGGTCAGCAACGTTGAG	45
GFP_split_A_FP	gaattcgcggccgcttctagagatgcgtaaaggagaagaacttttc	46
GFP_split_B_RP	ctgccgctgctgccgctgctgccttattatttgtatagttcatccatgcca	51
GFP_split_A_RP	gctgccgctgctgccgctgctgccttgtttgtctgccatgatgtatac	48
GFP_split_B_FP	gctgccgctgctgccgctgctgcctttgtatagttcatccatgccatg	48
aptamer_FP	gcttctagagacactcggaggacagcttagatgcaaagccggagtgagtgtacacc	56
aptamer_RP	agcctgcagcggccgctactagtattcccctggcgcggggtgtacactcactccggct	58
eIFA_FP	gcttctagATGGAGCCGGAAGGCGTCATCGA	31
eIF4A_mut1_FP	ccatatcaattctccagcagattga	25
eIF4A_mut1_RP	caatctgctggagaattgatatggc	25
eIF4A_mut2_FP	gcagaagctccagatggaa	19
eIF4A_mut2_RP	tccatctggagcttctgca	19
eIF4A_split_A_Rp	ctgcagcggccgctactagtatcaagggtctctcataaatttcttgg	47
eIF4A_split_B_Fp	cggcagcagcggcagcggcagcattcggattcttgtcaagaagg	44
RFP_split_A_FP	gaattcgcggccgcttctagatggcttcctccgaagac	38
RFP_split_A_RP	gctgccgctgctgccgctgctgccgtcttccgggtacatacgtt	44
RFP_split_B_FP	gaattcgcggccgcttctagatgggtgctctgaaaggtgaaatc	44
RFP_split_B_RP	gctgccgctgctgccgctgctgccagcaccggtggagtga	40
Total		773

Speedy Switch

name	sequence	length
Theophylline Riboswitch FP	gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag	56
Theophylline Riboswitch RP	ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac	62

Speedy Protein Degrader

name	sequence	length	desc
GFPLVA_out_FP	gcttctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc	52
RFPLVA_out_FP	gcttctagagaaagaggagaaatactagatggct	34
RFPLVA_in_RP	CTACTAAAGCGTAGTTTTCGTCGTTTGCAGCagcaccggtggagtga	47
SspB_FP	gcttctagatgGATTTGTCACAGCTAACAC	30
SspB_RP	ctgcagcggccgctactagtattaCTTCACAACGCGTAATGC	41
RFP_FP	gcttctagatggcttcctccgaagac	26
GFP_FP	gcttctagatgcgtaaaggagaagaacttttc	32
xFP_LVA_Remover_FP	gagctgtacaagaggccttaataatactagagccaggcatca	42
xFP_LVA_Remover_RP	tgatgcctggctctagtattattaaggcctcttgtacagctc	42
Total		346

---