Plasmid Construction
From 2010.igem.org
(New page: Construction plasmid is uncut backbone plasmid DNA from the three different plasmid backbones used for three antibiotic assembly (pSB1C3, pSB1K3, and pSB1T3). Once it is cut with EcoRI and...)
Newer edit →
Revision as of 19:21, 9 July 2010
Construction plasmid is uncut backbone plasmid DNA from the three different plasmid backbones used for three antibiotic assembly (pSB1C3, pSB1K3, and pSB1T3). Once it is cut with EcoRI and PstI it is ready for use in three way ligation reactions. Ideally, it is free of inserts and circular DNA. There are several ways to make construction plasmids. Our original approach was to use plasmid containing the P1010 insert, coding for the ccdB protein generator. This protein product is toxic to cells not having the gyrA462 mutation (most strains except for DB3.1). As a result, uncut or religated plasmid would produce little background. In our experience, this approach has a number of difficulties. Extraction of cut backbone from inserts required the use of gel purification, which is difficult with high concentrations of DNA, and problematic in yield and quality. The P1010 insert also showed remarkable ability to mutate (usually by frame shift) to a form not toxic to normal cells, leading to significant background. Our revised approach is to build construction plasmid using PCR techniques. Using primers which match the biobrick cloning sites in the reverse orientation, we produce PCR product containing the plasmid backbone with no insert and no uncut, circular plasmid. Errors are introduced in this PCR process, but the errors are of two forms: ones which result in plasmids which cannot be transformed, and those which produce viable, but mutated plasmid backbone. In either case, we don't care, since the insert sequence is what we care about. The PCR product is cut with EcoRI and PstI, purified away from the short dsDNA fragments cut off, and used for assemblies. Since the quality of this construction plasmid is a key determiner in the success of three antibiotic cloning, substantial effort has been put into optimizing the reactions. This protocol describes the exact procedures and quality control techniques used to make the construction plasmid backbones.
Contents [hide] 1 PCR 1.1 Materials 1.2 PCR reaction 2 Purification 2.1 Qiagen purification option 2.2 Proteinase K / Phenol-chloroform option 2.2.1 Materials 2.2.2 Proteinase K 2.2.3 Phenol chloroform extraction 3 Restriction enzyme digest [edit]PCR
[edit]Materials Template DNA for the backbone of choice (any plasmid with the correct backbone) at 10 ng/μl concentration. Invitrogen PCR Supermix High Fidelity (Invitrogen 10790-020) Primer Suffix-F, sequence actagtagcggccgctgcag at 30 pmol/μl Primer Prefix-R, sequence tctagaagcggccgcgaattc at 30 pmol/μl
[edit]PCR reaction Mix a PCR reaction consisting of: 300 μl PCR supermix 6 μl each primer 0.5 μl template DNA Aliquot into 100 μl samples for the cycler
Run this PCR program: initial denaturing 95 C for 5 minutes denature 94 C for 30 s anneal 55 C for 30 s extend 68 C for 4 minutes cycle 36 times to step 2 final extension 68 C for 10 minutes hold at 4 C indefinitely
[edit]Purification
[edit]Qiagen purification option We have also used a Qiagen PCR purification kit to get rid of the enzymes in the PCR reaction. It is ideal to use the PCR product that has been Qiagen PCR purified immediately after purification.
[edit]Proteinase K / Phenol-chloroform option [edit]Materials 10x proteinase K digestion mix 500 μg/ml proteinase K (50 μl of a 10 mg/ml solution) 80 mM EDTA (160 μl of a 500 mM solution) 5% SDS (250 μl of a 20% solution) water (540 μl to bring to 1 ml) Store at -20 C Phenol/chloroform/isoamyl alcohol (pH 7.5, buffered, Sigma P3803) 0.6 ml thick walled eppendorf tubes (thin ones will not work) Chloroform/isoamyl alcohol (Sigma C0549) Sodium acetate 3M pH 5.2 Pellet paint NF (Novagen 70748) ice cold absolute ethanol 70% ethanol, room temperature TE or 10 mM Tris-HCl pH 7.5 [edit]Proteinase K The purpose of this step is to degrade any remaining polymerase enzymes. This improves cloning efficiency when starting from PCR products [1]. consolidate 300 μl sample into a single tube add 33 μl of the 10x Proteinase-K digestion mix incubate at 50 C for 1 hour denature the proteinase K at 70 C for 15 minutes [edit]Phenol chloroform extraction split the digestion equally into two thick walled 0.6 ml eppendorf tubes (thin tubes will fail catastrophically at high speed in the centrifuge) add 150 μl Phenol/chloroform/isoamyl alcohol (caution!) to each tube (pipet from the bottom layer of the bottle, avoiding the top buffer layer) vortex thoroughly and spin 1 minute at 8000g remove most of the bottom layer of phenol/chloroform by pipetting from the bottom layer carefully pipet the top layer into a second set of 0.6 ml thick wall tubes, avoiding the phenol/chloroform layer add 150 μl chloroform/isoamyl alcohol to each tube vortex thoroughly and spin 1 minute at 8000g remove most of the bottom layer of chloroform by pipetting from the bottom layer carefully pipet the top layer into a third set of 0.6 ml tubes, avoiding the chloroform layer add 15 μl sodium acetate 3M pH 5.2 to each tube Add 1 μl Pellet paint NF to each tube Add 400 μl ice cold absolute ethanol to each tube vortex and place in the -80 freezer for 1/2 hour until a gel like consistency forms remove from the freezer and spin at the highest available speed for 20 minutes, forming a visible blue pellet remove the supernatant, spin briefly again, and remove residual supernatant with a 10 μl pipet tip Add 500 μl 70% ethanol vortex, spin again at high speed to re-pellet the DNA remove the supernatant, spin briefly again, and remove residual supernatant with a 10 μl pipet tip allow the pellet to dry briefly (10 minutes, until the alcohol smell is gone) redissolve the pellet in 100 μl TE or 10 mM Tris-HCl pH 7.5 measure the DNA concentration on a Nanodrop. Expect 400-500 ng/μl or a total of approximately 80 μg of DNA.
[edit]Restriction enzyme digest
Once your plasmid backbone has been amplified and purified you must digest it with the flanking restriction enzymes that you used to cut your two parts that you are assembling. In assembly standard #10 (BioBrick standard assembly) you would use EcoRI and PstI. You can use the digested product directly in the ligation after having digested (@37 degrees) and heat killing (@80 degrees). It is best to use it soon after the reaction has completed. Alternatively you can do another purification and store the product at -20 degrees.