Team:Heidelberg/Project/miMeasure
From 2010.igem.org
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
(→Analysis of Randomized Binding Sites Against Synthetic miRNA) |
||
Line 38: | Line 38: | ||
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS | |ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS | ||
|- | |- | ||
- | |ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| | + | |ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG |
|- | |- | ||
- | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12|| | + | |ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA |
|- | |- | ||
- | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12|| | + | |ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12ACGG |
|- | |- | ||
- | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12|| | + | |ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12ATGT |
|- | |- | ||
- | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10G |
|- | |- | ||
- | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10|| | + | |ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10A |
|- | |- | ||
- | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11|| | + | |ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11A |
|- | |- | ||
- | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18|| | + | |ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18ATG |
|- | |- | ||
|-||miMeasure without any binding site||NC (negative control) | |-||miMeasure without any binding site||NC (negative control) |
Revision as of 11:37, 27 October 2010
|
|
||||||||||||||||||||||||||||||||||||||||||