Team:ESBS-Strasbourg/Results/Biobricks

• PIF3
• PIF6
• PHY B 900
• PHY B 650
• ∆N-ClpX
• linker
• LAA Tag
• DAS Tag
• Lambda Tag
• GFP (super fold)
• PhyB642-(linker-∆NClpX)3
• PhyB908-(linker-∆NClpX)3
• Full-length ClpX
• ∆NClpX-linker-∆NClpX-linker-∆NClpX
• (linker-∆NClpX)3

other link if needed

      

Part Number:	Part Name:	Plasmid/Resistance	Status
BBa_K365000	Phytochrome Interacting Factor-3 (PIF3)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365001	Phytochrome Interacting Factor-6 (PIF6)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365002	Phytochrome B (aa 1-908)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365003	Phytochrome B (aa 1-642)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365004	∆N-ClpX (aa 61-425)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365005	Linker (aa 20)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365006	LAA tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365007	DAS tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365008	Lambda tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365009	GFP (super fold)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365010	PhyB642-(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365011	PhyB908-(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365012	Full-length ClpX	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365013	∆NClpX-linker-∆NClpX-linker-∆NClpX	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365014	(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Sequenced

Background:

PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.

Conception:

The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 (Lim & Voigt, 2009.)
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.
PIF3
The plasmid containing the PIF3-sequence was provided by the laboratory of Stephan Kircher from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 51 bp
GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC

Reverse primer (5’->3’): 51 bp
ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC

In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’) (24 bp)
GCAAACTCTTCAAGAGCTAGAGAG

Reverse primer (5’->3’) (24 bp)
CTCTCTAGCTCTTGAAGAGTTTGC

Background:

For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, (Lim & Voigt, 2009.) screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to coexpressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane.

Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF
pairs in a fluorescence translocation assay.

Conception: We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by (Lim & Voigt, 2009.).

PIF6

The plasmid containing the PIF6-sequence was provided by the laboratory of Wilfried Weber) from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 54 bp
GGATCCgaattcgcggccgcttctagatggccggcATGATGTTCTTACCAACCG

Reverse primer (5’->3’): 58 bp
CAGCTGctgcagcggccgctactagtattaaccggtGTCAACATGTTTATTGCTTTCC

...

...

...

...

...

...

...

...

...

...

...

...

...

...