Team:Groningen/28 June 2010
From 2010.igem.org
Line 24: | Line 24: | ||
ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively. | ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively. | ||
+ | |||
<pre>- 13ul plasmid | <pre>- 13ul plasmid | ||
Line 32: | Line 33: | ||
[[Image:02-07-10gn.jpg|200px|thumb|left|alt text]] | [[Image:02-07-10gn.jpg|200px|thumb|left|alt text]] | ||
<br style="clear: both" /> | <br style="clear: both" /> | ||
+ | |||
{{Team:Groningen/Footer}} | {{Team:Groningen/Footer}} |
Revision as of 14:19, 23 October 2010
Week 26, Arend Jan
The construct was sent for sequencing (ServiceXS) to sequence the region where the Biobrick sites were inserted, and to sequence the unknown sequence containing the PstI site, using the following primers.
3'RepA-seq-for: ATTGAGAGGAGGGATTATTG
5'Cm-seq-rev: GAGTTTATCACCCTTGTC
3'Cm-seq-for: TTCAGGAATTGTCAGATAGG
The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.
The PstI site prevents us from inserting two biobricks at once into our expression plasmid. As our synthesized chaplin genes have arrived we will start inserting single genes into the plasmid, not using PstI.
ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively.
- 13ul plasmid - 1.5ul buffer R - 0.5ul EcoRV/HindIII [[Image:02-07-10gn.jpg|200px|thumb|left|alt text]] <br style="clear: both" /> {{Team:Groningen/Footer}}