Team:Groningen/28 June 2010

From 2010.igem.org

(Difference between revisions)
Line 15: Line 15:
The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.  
The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.  
 +
[[Image:PNZ8901-bbs-ins.jpg|200px|thumb|left|alt text]]
[[Image:PNZ8901-bbs-ins.jpg|200px|thumb|left|alt text]]
 +
<br style="clear: both" />
 +
 +
 +
The PstI site prevents us from inserting two biobricks at once into our expression plasmid. As our synthesized chaplin genes have arrived we will start inserting single genes into the plasmid, not using PstI.
 +
 +
ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively.
 +
 +
<pre>- 13ul plasmid
 +
- 1.5ul buffer R
 +
- 0.5ul EcoRV/HindIII
 +
 +
 +
[[Image:02-07-10gn.jpg|200px|thumb|left|alt text]]
<br style="clear: both" />
<br style="clear: both" />
{{Team:Groningen/Footer}}
{{Team:Groningen/Footer}}

Revision as of 14:18, 23 October 2010

iGEM Groningen 2010

Hydrophobofilm
pushing coatings into a greener future

Week 26, Arend Jan


The construct was sent for sequencing (ServiceXS) to sequence the region where the Biobrick sites were inserted, and to sequence the unknown sequence containing the PstI site, using the following primers.


3'RepA-seq-for: ATTGAGAGGAGGGATTATTG

5'Cm-seq-rev: GAGTTTATCACCCTTGTC

3'Cm-seq-for: TTCAGGAATTGTCAGATAGG


The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.


alt text



The PstI site prevents us from inserting two biobricks at once into our expression plasmid. As our synthesized chaplin genes have arrived we will start inserting single genes into the plasmid, not using PstI.

ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively.

- 13ul plasmid
- 1.5ul buffer R
- 0.5ul EcoRV/HindIII


[[Image:02-07-10gn.jpg|200px|thumb|left|alt text]]
<br style="clear: both" />

{{Team:Groningen/Footer}}