"
Team:Groningen/28 June 2010
From 2010.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
{{Team:Groningen/Header}} | {{Team:Groningen/Header}} | ||
| - | '''Week 26''' | + | '''Week 26, Arend Jan''' |
| + | The construct was sent for sequencing (ServiceXS) to sequence the region where the Biobrick sites were inserted, and to sequence the unknown sequence containing the PstI site, using the following primers. | ||
| + | |||
| + | 3'RepA-seq-for: ATTGAGAGGAGGGATTATTG | ||
| + | 5'Cm-seq-rev: GAGTTTATCACCCTTGTC | ||
| + | 3'Cm-seq-for: TTCAGGAATTGTCAGATAGG | ||
| + | |||
| + | |||
| + | The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid. | ||
{{Team:Groningen/Footer}} | {{Team:Groningen/Footer}} | ||
Revision as of 13:29, 23 October 2010
Hydrophobofilm
pushing coatings into a greener future
Week 26, Arend Jan
The construct was sent for sequencing (ServiceXS) to sequence the region where the Biobrick sites were inserted, and to sequence the unknown sequence containing the PstI site, using the following primers.
3'RepA-seq-for: ATTGAGAGGAGGGATTATTG
5'Cm-seq-rev: GAGTTTATCACCCTTGTC
3'Cm-seq-for: TTCAGGAATTGTCAGATAGG
The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.
