Motivation

  There are many kinds of diseases that mankind is suffering. When we talk about this topic, we can think easily three issues which are malaria, HIV and tuberculosis. Malaria is a disease that is transmitted from human to human by mosquitoes. Each year, malaria causes nearly one million deaths and the majority of them occur in developing countries. And this disease is high-risk in children, pregnant women, travelers, refugees, displaced persons, and laborers entering endemic areas. In case HIV, there are 33 million people infected in the world and 95 percent of them are living in developing countries. At last, for tuberculosis, it caused by mycobacterium tuberculosis which affects lungs most. Until now, more than 2 billion people are infected with tuberculosis bacilli and 90 percent of them are in developing countries. As we can see, all of these diseases are very problematic in developing country.There are many kinds of diseases that mankind is suffering. When we talk about this topic, we can think easily three issues which are malaria, HIV and tuberculosis. Malaria is a disease that is transmitted from human to human by mosquitoes. Each year, malaria causes nearly one million deaths and the majority of them occur in developing countries. And this disease is high-risk in children, pregnant women, travelers, refugees, displaced persons, and laborers entering endemic areas. In case HIV, there are 33 million people infected in the world and 95 percent of them are living in developing countries. At last, for tuberculosis, it caused by mycobacterium tuberculosis which affects lungs most. Until now, more than 2 billion people are infected with tuberculosis bacilli and 90 percent of them are in developing countries. As we can see, all of these diseases are very problematic in developing country.

  In developing country, there are not much money and technology in medical development for testing and treating diseases. But unfortunately, basic medical tests like blood tests and biopsy and others need certain level of technical development. In addition, at some areas in developing countries doesn’t have electricity or access to high technology equipments. Therefore, we need new diagnosis system for disease test. For our system, we choose tuberculosis as a target. As the history goes on, technology related to diagnosis and treatment of tuberculosis has been developed. Especially for diagnosis, people do Tuberculin Skin Test, X-ray Test for its activation and examination of the sputum today. In addition, people take a blood test that involves ESR, white blood cell, CRP status checking. If necessary, CT and endoscopy can be added. Unfortunately, however, most of these tests require high technology and proper machines to process. Therefore, in developing countries these tests can be very hard to operate. As a solution, we think of a new idea for new diagnosis system.

  As the advanced version of diagnosis method, we suggest a system using antigen-antibody reaction. Actually, antibody can’t release signals by antigen-antibody reaction. So, we thought of fusion antibody-receptor as solution. Fusion antibody-receptor is a receptor which fused with other functional protein, antibody. In this way, we can get result by gene expression which would generally be GFP expression after our system is triggered by our target antigens. As a result, we can get possibility to make universal sensor by changing only target antigen’s antibody in fusion antibody-receptor. It should be very easy to diagnosis without heavy technology in the future.

Whole Pathway

Antibodies for Detecting Cancer Cells

  Cancer cell has distinctive protein expression pattern. This expression pattern also varies on the cell line of cancer cell. For example CD15 and CD30 proteins are OVEREXPRESSED on Hodgkin’s disease, kind of lymphoma, and CEA is over-expressed on adenocarcinoma cell. These protein expression patterns also vary on the cell line of cancer. For example breast cancer cell has different protein expression pattern; over-expression of Estrogen receptor, Progesterone receptor and KI67 of MCF-7 cell line and over-expression of Human Epidermal Growth Factor receptor, KI67 of AU-56 or SK-BR-3 cell line. Therefore, it allows us to know not only the existence of cancer, but also the type of cell line to identify the protein expression pattern of biopsy sample. We selected Estrogen Receptor and HER2 for our project to make a diagnosis the breast cancer. The reason why we selected these proteins is that they are differently over-expressed. Comparing over-expression pattern of these proteins can diagnose existence of cancer and type of cancer.

Making Biosensor – Yeast Cancer Detector

  A biosensor is a device for the detection of an analyst that combines a biological component with a physicochemical detector component.[1] In order to make biosensor with genetically engineered organism, we should consider the following basic sensing process.

  The ‘Receive input’ part can be alternated by represented receptor, the ‘Process’ part can be signaling pathway which changes input to output, and the ‘Extract output’ part can be something easily detectable by human. Nowadays, pigments or fluorescence proteins are usually used for output, and in order to express these substances, gene expression is made constant use in genetically modified organism. Thus, all engineered biosensors with organisms should be modeled on (consist of) 1) biochemical receptors which can activate gene expression, 2) biological pathway, and 3) gene activation for output.

Why Yeast?

  Why we use ‘Yeast’ instead of ‘E. coli’? E. coli control is easier than Yeast control. E. coli has faster cell cycle than Yeast. Moreover, there are many E. coli templates. But, although E. coli has many profits, we choose Yeast. Why? The following table is E. coli properties.[2]

  According to the table, we can find easily some reasons that E. coli cannot work human pathway well.

  First, the periplasm’s thickness of E. coli is the very small as 10nm. In our project, we have to use human proteins. Almost human proteins are much bigger than E. coli’s proteins. (They are over 10nm*10nm*10nm.) Furthermore, in our project, STAT3 has 60nm height. Therefore, this protein cannot be in periplasm, and our pathway cannot work completely.[3]

  Second, the average E. coli protein has only 360 residues, 5nm diameter, and 40kD MW. As we mentioned, our project’s proteins have over 1000residues, 10nm diameter and 50kD MW. Thus, the possibility that E. coli have our pathway is very low.

  However, Yeast has big volume size from 3~4 µm to 40 µm. [4] And Yeast is a eukaryotic, so it is more similar to human cell than E. coli. There is no physical problem of using human protein in yeast. And has more possibility to do our pathway. Therefore, we use Yeast instead of E. coli.


Minimal genome fission yeast


  
Porting of cell signal transduction pathway is not easy for wild type organism. Most important reason is unwanted protein degradation. For wild type organism, unfamiliar protein can be harmful because it may be fragmented or misfolded proteins which disturb cellular pathway or viral proteins which may infect organisms. So wild type organism degrade unfamiliar proteins whether it is really harmful or not. And even degradation of at least one element of signal transduction pathway can disconnect whole pathway. So for successful porting of cell signal transduction pathway, inhibition of protease is important. Another problem is signal confusion. Basically, cellular signal transduction pathway is based on the protein-protein interaction(PPI). So unwanted PPI with elements of ported signal transduction pathway can confuse the signal. Of course if origin species of ported pathway is far enough from target species, we can exclude predictable unwanted PPI to avoid homologous proteins. But there are many unpredictable PPIs which can confuse the pathway. To avoid this problems, deletion of unnecessary proteins is required. And fission with minimal genome is made[5]. This yeast have only 1033 necessary genes of 5776 genes from wild type. So it may be useful to port cell signal transduction pathway from other organism(Human) without unwanted protein degradation or signal confusion

Biochemical Receptors

  The upper table represents classification of all biological receptors. First of all, since our genetically engineered machine has to detect on cancer cell directly, we should select cell surface receptors. Next, we should consider using fusion-antibody-receptors. We used gene combination simply (add antibody to biological receptor without original receipt part). If the receptor has conformational change property when it accepts input signal, we guess that our fusion antibody receptor cannot operate well because antibodies characteristics (antigen size, antibody size, etc.) are different. They don’t have special receipt part in a whole receptor, of course, so whole receptor is important receipt part; we cannot create fusion-antibody-receptor with this protein anyway. Therefore, we choose ‘Dimerization’ receptor. Most of these receptors have Immunoglobulin-like receptor part which can be alternated by antibodies easily. Also, since biosensors should activate gene expression, we selected gene-regulation related receptors.

  Finally we choose cytokine receptors and receptor tyrosine kinases. Among them, interleukin-6 alpha receptor was selected.

Fusion Antibody Receptors

  The Fusion Antibody-Receptor is a protein which receptor genetically combines with a specific antibody. The following figures show what the fusion antibody-receptor is for details.

  The fusion antibody-receptor is designed by simple gene modification. We altered the cancer detectable antibody single chain instead of the cytokine receptor’s antigen acceptable part (Immunoglobulin-like parts). Light chain part of the antibody – Linker – Heavy chain part of antibody is enough. (There are some evidences to success making fusion antibody-receptor with this method in some experiments. [4]) Then in order to express the receptor on cell surface membrane of Yeast, we change the original signal peptide to Omp(Outer membrane protein) signal peptide of Yeast. Surely the receptor should satisfy our standard for biosensor.

  Schizosaccharomyces pombe Signal peptide from Cell wall integrity and stress response component 1

  Protein sequence:
  MVFLNSSPFKGRLLFFVYLLIISTRLVAA

  mRNA sequece:
  atggtgtttctgaacagcagcccgtttaaaggccgcctgctgttttttgtgtatctgctgattattagcacccgcctggtggcggcg

Signal Pathway : JAK-STAT Pathway

  There are many signal pathways from plasma membrane receptor to the gene regulation. Figure B is an example of these pathways, MAP kinase pathway linked with RAS pathway. In this pathway,

1. With existence of signal molecule, receptor kinases dimerize themselves and phosphorylate each other.
2. This phosphorylated receptor dimer is cognized by Grb2 and recruit SOS protein, the Guanine nucleotide Exchange Factor(GEP)
3. Recruited SOS protein substitute as GDP of Ras protein with GTP.
4. Ras protein with GTP changes its conformation and activate its own kinase activity(Ras pathway so far)
5. Ras kinase activate the MAP kinase kinase kinase, MAP KKK(also called as Raf protein) with phosphorylation
6. MAP KKK activates the MAP kinase kinase, MAP KK(also called as Mek) with phosphorylation
7. MAP KK activates the MAP kinase, MAP K(also called as Erk) with phosphorylation
8. Activated MAP Kinase phosphorylates many cytosol proteins.
9. For example, if Jun TF is phosphorylated by MAP K, phosphorylated Jun go inside of nucleus and activate the transcription to bind to DNA. (MAP pathway so far)

  But to port this signal pathway into the Yeast is not easy because this pathway is related with too many new proteins, while JAK-STAT pathway is easy to port because it doesn’t have many participating proteins. The signal transduction step of JAK-STAT pathway as follows.

1. Cytokine binds to the cytokine receptor with JAK kinase.
2. Kinases form dimer and are phosphorylated by JAK.
3. These phosphorylated tyrosine residue is cognized by STAT protein.
4. STAT which cognize phosphorylated tyrosine phosphorylate other STAT protein.
5. Two phosphorylated STAT protein form dimer and go inside to the nucleus and activate near gene to bind to the GAS motif.

  Because JAK-STAT pathway have only 5 steps while RAS-MAP pathway require 9 steps, we decide to port JAK-STAT pathway to the Yeast.

   Actually, there are many JAK-STAT pathways in human cell. JAK and STAT are important components of many cytokine receptor systems. According to combination of the receptor, JAK and STAT, there exits many pathways which acts different works in eukaryotic cell. Among these pathways, we choose IL-6α, JAK1, STAT3 pathway. In this pathway, gp130 dimer and LMO4 are combined with JAK1, and assists a whole response. Why we selected the IL-6α specially? That is, IL-6α is a unique receptor which has a Ig-like region at outer part as different with other cytokine receptors. The introduction of IL-6α, gp130, and LMO4 are below.

Gene Activation for Output

STAT1 and STAT3 proteins with the formation of STAT3/3 and STAT1/3 dimers are confirmed using probe, namely the APRE probe. APRE probe(Acute-phase response element probe) is the acute phase responsive element of the α2M gene promoter and known to bind STAT1 and STAT3 proteins. Using this pathway, we altered the green fluorescent protein (GFP) gene instead of cytokine inducible genes. So, we could show GFP expression through the previous whole pathway.[Fig. 5]

References

Fig 1. Female cancer incidence worldwide, MRC, National Institute for Medical Research

http://www.nimr.mrc.ac.uk/virology/doorbar/fig1/

Fig 2. Nature Biotechnology 22, 6 - 7 (2004)

http://www.nature.com/nbt/journal/v22/n1/full/nbt0104-6.html

Fig 3.Bon cancer symptoms (2008)

http://bonecancersymptoms.org/

Fig 4. Charlotte Mulvihill, author. Licensed for use, ASM MicrobeLibrary

http://vivo.cornell.edu/individual/vivo/individual847

Fig 5. RCSB Protein Database “Crystal structure of the hexameric human IL-6/IL-6 alpha receptor/gp130 complex”

http://www.rcsb.org/pdb/explore/explore.do?structureId=1P9M

Fig 7. Invitrogen “JAK STAT”

http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cell-and-Tissue-Analysis/Signaling-Pathways/Jak-STAT.html

Fig 8. Akihiko Yoshimura, Hitomi Nishinakamura, Yumiko Matsumura and Toshikatsu Hanada, Negative regulation of cytokine signaling and immune responses by SOCS proteins, Arthritis Research & Therapy(2005)

Fig 9. RCSB Protein Database “THIRD N-TERMINAL DOMAIN OF GP130”

http://www.rcsb.org/pdb/explore/explore.do?structureId=1BJ8

Fig 10. RCSB Protein Database “Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain”

http://www.rcsb.org/pdb/explore/explore.do?structureId=1RUT

Fig 11. Roberto, Proteína fluorescente verde – história e perspectivas, Química de Produtos Naturais (2009)

[1] International Union of Pure and Applied Chemistry. "biosensor". Compendium of Chemical Terminology :: Internet edition.

[2] Garrett, R.H., and Grisham, C.M. Biochemistry, 2nd Edition (2002), pg. 32

[3] RCSB PDB(protein database), http://www.rcsb.org/

[4] Walker K, Skelton H, Smith K. (2002). accessdate=2009-11-28 "Cutaneous lesions showing giant yeast forms of Blastomyces dermatitidis". Journal of Cutaneous Pathology 29 (10): 616–18. doi:10.1034/j.1600-0560.2002.291009.x

[5] Dong-Uk Kim et.al, "Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe", Nat.Biotechnol(2010)

[6] Uniprot Database “Interleukin-6 receptor subunit alpha”; http://www.uniprot.org/uniprot/P08887

[7] Lichtman, Andrew H.; Abbas, Abul K. Cellular and molecular immunology (5th ed.). (2003). Philadelphia Saunders. ISBN 0-7216-0008-5.

[8] SR Roffler1,6, H-E Wang2,6, H-M Yu2, W-D Chang3,4, C-M Cheng3,4, Y-L Lu5, B-M Chen1 and T-L Cheng3,4. A membrane antibody receptor for noninvasive imaging of gene expression. Gene Therapy. Nature (2005)

[9] Martine I. Darville, Ye-Shih Ho and Decio L. Eizirik, NF-B Is Required for Cytokine-Induced Manganese Superoxide Dismutase Expression in Insulin-Producing Cells, The Endocrine Society(2000)