Team:NYMU-Taipei/Experiments
From 2010.igem.org
(Difference between revisions)
(→Experiments) |
(→Parts) |
||
Line 20: | Line 20: | ||
* [[Team:NYMU-Taipei/Experiments/dddddH2O|dddddH2O preparation]] (fun :P) | * [[Team:NYMU-Taipei/Experiments/dddddH2O|dddddH2O preparation]] (fun :P) | ||
- | = Parts = | + | = <font color=blue>Parts</font> = |
The range given to each group for this years' parts was divided as follows: | The range given to each group for this years' parts was divided as follows: | ||
* Speedy Switch: K411000-K411099 | * Speedy Switch: K411000-K411099 | ||
Line 28: | Line 28: | ||
The designed parts: | The designed parts: | ||
<groupparts>iGEM010 NYMU-Taipei</groupparts> | <groupparts>iGEM010 NYMU-Taipei</groupparts> | ||
- | |||
- | |||
= Primers = | = Primers = |
Revision as of 14:01, 27 October 2010
Home | Project Overview | Speedy reporter | Speedy switch | Speedy protein degrader | Experiments and Parts | Applications | F.A.Q | About Us |
Contents |
Experiments
Lab notebooks:
Experimental results:
- Speedy switch results: Several reporter gene assay results for testing the Theophylline riboswitch.
- Speedy degrader results: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.
Protocols, preparation and other stuff
- Basic cloning protocols. Optimised protocols developed and kept current over the past few years.
- Gene reporter assay protocols
- pSB1C3 preparation
- dddddH2O preparation (fun :P)
Parts
The range given to each group for this years' parts was divided as follows:
- Speedy Switch: K411000-K411099
- Speedy Reporter: K411100-K411199
- Speedy Protein degrader: K411200-K411299
The designed parts: <groupparts>iGEM010 NYMU-Taipei</groupparts>
Primers
A list of all the primers we ordered.
Speedy Reporter
name | sequence | length | desc |
---|---|---|---|
eIF4A_split_A_Fp | cggcagcagcggcagcggcagcATGGAGCCGGAAGGCGTCATCGA | 45 | |
eIF4A_split_B_Rp | ctgcagcggccgctactagtaTCAAATGAGGTCAGCAACGTTGAG | 45 | |
GFP_split_A_FP | gaattcgcggccgcttctagagatgcgtaaaggagaagaacttttc | 46 | |
GFP_split_B_RP | ctgccgctgctgccgctgctgccttattatttgtatagttcatccatgcca | 51 | |
GFP_split_A_RP | gctgccgctgctgccgctgctgccttgtttgtctgccatgatgtatac | 48 | |
GFP_split_B_FP | gctgccgctgctgccgctgctgcctttgtatagttcatccatgccatg | 48 | |
aptamer_FP | gcttctagagacactcggaggacagcttagatgcaaagccggagtgagtgtacacc | 56 | |
aptamer_RP | agcctgcagcggccgctactagtattcccctggcgcggggtgtacactcactccggct | 58 | |
eIFA_FP | gcttctagATGGAGCCGGAAGGCGTCATCGA | 31 | |
eIF4A_mut1_FP | ccatatcaattctccagcagattga | 25 | |
eIF4A_mut1_RP | caatctgctggagaattgatatggc | 25 | |
eIF4A_mut2_FP | gcagaagctccagatggaa | 19 | |
eIF4A_mut2_RP | tccatctggagcttctgca | 19 | |
eIF4A_split_A_Rp | ctgcagcggccgctactagtatcaagggtctctcataaatttcttgg | 47 | |
eIF4A_split_B_Fp | cggcagcagcggcagcggcagcattcggattcttgtcaagaagg | 44 | |
RFP_split_A_FP | gaattcgcggccgcttctagatggcttcctccgaagac | 38 | |
RFP_split_A_RP | gctgccgctgctgccgctgctgccgtcttccgggtacatacgtt | 44 | |
RFP_split_B_FP | gaattcgcggccgcttctagatgggtgctctgaaaggtgaaatc | 44 | |
RFP_split_B_RP | gctgccgctgctgccgctgctgccagcaccggtggagtga | 40 | |
Total | 773 |
Speedy Switch
name | sequence | length |
---|---|---|
Theophylline Riboswitch FP | gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag | 56 |
Theophylline Riboswitch RP | ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac | 62 |
Speedy Protein Degrader
name | sequence | length | desc |
---|---|---|---|
GFPLVA_out_FP | gcttctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc | 52 | |
RFPLVA_out_FP | gcttctagagaaagaggagaaatactagatggct | 34 | |
RFPLVA_in_RP | CTACTAAAGCGTAGTTTTCGTCGTTTGCAGCagcaccggtggagtga | 47 | |
SspB_FP | gcttctagatgGATTTGTCACAGCTAACAC | 30 | |
SspB_RP | ctgcagcggccgctactagtattaCTTCACAACGCGTAATGC | 41 | |
RFP_FP | gcttctagatggcttcctccgaagac | 26 | |
GFP_FP | gcttctagatgcgtaaaggagaagaacttttc | 32 | |
xFP_LVA_Remover_FP | gagctgtacaagaggccttaataatactagagccaggcatca | 42 | |
xFP_LVA_Remover_RP | tgatgcctggctctagtattattaaggcctcttgtacagctc | 42 | |
Total | 346 |