Team:Panama/13 August 2010
From 2010.igem.org
(→PCR Rhlab amplification) |
Nikkibiotech (Talk | contribs) (→PCR Rhlab amplification) |
||
Line 119: | Line 119: | ||
'''RESULTS''' | '''RESULTS''' | ||
+ | |||
[[Image:Cuadro_13_agosto3.jpg|315px|thumb|left|alt text]] | [[Image:Cuadro_13_agosto3.jpg|315px|thumb|left|alt text]] | ||
+ | |||
Line 136: | Line 138: | ||
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM. | We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM. | ||
+ | |||
{{:Team:Panama/calendar2}} | {{:Team:Panama/calendar2}} |
Revision as of 13:56, 27 October 2010
August 13
Digestion Reaction
Today we did the digest the plasmid that contain the promoter with the EcoRI and SpeI enzymes, and the plasmid with the RBS was digested with the XhaI and PstI enzymes.
RESULTS
PCR Rhlab amplification
Now that we have our Rh1ab we are going to run a PCR of it using our first set of primers.
RhT-F1a 5' GCGATAGCTGTTTGCCTGTT 3'
RhT-R2a 5' TGGCAACCCTATCTGTTATGC 3'
First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM.
RESULTS
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.
|
|
|
|
|
|