Team:Panama/13 August 2010

From 2010.igem.org

(Difference between revisions)
(PCR Rhlab amplification)
(PCR Rhlab amplification)
Line 119: Line 119:
'''RESULTS'''
'''RESULTS'''
 +
[[Image:Cuadro_13_agosto3.jpg|315px|thumb|left|alt text]]
[[Image:Cuadro_13_agosto3.jpg|315px|thumb|left|alt text]]
 +
Line 136: Line 138:
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.
 +
{{:Team:Panama/calendar2}}
{{:Team:Panama/calendar2}}

Revision as of 13:56, 27 October 2010

iGEM Panama

  • Decrease font size
  • Default font size
  • Increase font size
  • default color
  • color1 color
  • color2 color
  • color3 color

August 13

Digestion Reaction

Today we did the digest the plasmid that contain the promoter with the EcoRI and SpeI enzymes, and the plasmid with the RBS was digested with the XhaI and PstI enzymes.

alt text









RESULTS

alt text





alt text



















PCR Rhlab amplification

Now that we have our Rh1ab we are going to run a PCR of it using our first set of primers.

RhT-F1a 5' GCGATAGCTGTTTGCCTGTT 3'

RhT-R2a 5' TGGCAACCCTATCTGTTATGC 3'

First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM.

alt text



alt text



alt text












RESULTS

alt text





alt text




We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.

May
MTWTFSS
          [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_May_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Team:Panama/2_May_2010&action=edit 2]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/3_May_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Team:Panama/4_May_2010&action=edit 4] [http://2010.igem.org/wiki/index.php?title=Team:Panama/5_May_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Team:Panama/6_May_2010&action=edit 6] [http://2010.igem.org/wiki/index.php?title=Team:Panama/7_May_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Team:Panama/8_May_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Team:Panama/9_May_2010&action=edit 9]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/10_May_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Team:Panama/11_May_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Team:Panama/12_May_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Team:Panama/13_May_2010&action=edit 13] [http://2010.igem.org/wiki/index.php?title=Team:Panama/14_May_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Team:Panama/15_May_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Team:Panama/16_May_2010&action=edit 16]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/17_May_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Team:Panama/18_May_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Team:Panama/19_May_2010&action=edit 19] [http://2010.igem.org/wiki/index.php?title=Team:Panama/20_May_2010&action=edit 20] [http://2010.igem.org/wiki/index.php?title=Team:Panama/21_May_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Team:Panama/22_May_2010&action=edit 22] [http://2010.igem.org/wiki/index.php?title=Team:Panama/23_May_2010&action=edit 23]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/24_May_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Team:Panama/25_May_2010&action=edit 25] [http://2010.igem.org/Team:Panama/26_May_2010 26] [http://2010.igem.org/wiki/index.php?title=Team:Panama/27_May_2010&action=edit 27] [http://2010.igem.org/wiki/index.php?title=Team:Panama/28_May_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Team:Panama/29_May_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Team:Panama/30_May_2010&action=edit 30]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/31_May_2010&action=edit 31]
June
MTWTFSS
  [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_June_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Team:Panama/2_June_2010&action=edit 2] [http://2010.igem.org/Team:Panama/3_June_2010 3] [http://2010.igem.org/Team:Panama/4_June_2010 4] [http://2010.igem.org/wiki/index.php?title=Team:Panama/5_June_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Team:Panama/6_June_2010&action=edit 6]
[http://2010.igem.org/Team:Panama/7_June_2010 7] [http://2010.igem.org/wiki/index.php?title=Team:Panama/8_June_2010&action=edit 8] [http://2010.igem.org/Team:Panama/9_June_2010 9] [http://2010.igem.org/wiki/index.php?title=Team:Panama/10_June_2010&action=edit 10] [http://2010.igem.org/Team:Panama/11_June_2010 11] [http://2010.igem.org/wiki/index.php?title=Team:Panama/12_June_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Team:Panama/13_June_2010&action=edit 13]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/14_June_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Team:Panama/15_June_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Team:Panama/16_June_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Team:Panama/17_June_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Team:Panama/18_June_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Team:Panama/19_June_2010&action=edit 19] [http://2010.igem.org/wiki/index.php?title=Team:Panama/20_June_2010&action=edit 20]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/21_June_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Team:Panama/22_June_2010&action=edit 22] [http://2010.igem.org/wiki/index.php?title=Team:Panama/23_June_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Team:Panama/24_June_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Team:Panama/25_June_2010&action=edit 25] [http://2010.igem.org/Team:Panama/26_June_2010 26] [http://2010.igem.org/wiki/index.php?title=Team:Panama/27_June_2010&action=edit 27]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/28_June_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Team:Panama/29_June_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Team:Panama/30_June_2010&action=edit 30]
July
MTWTFSS
      [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_July_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Team:Panama/2_July_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Team:Panama/3_July_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Team:Panama/4_July_2010&action=edit 4]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/5_July_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Team:Panama/6_July_2010&action=edit 6] [http://2010.igem.org/wiki/index.php?title=Team:Panama/7_July_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Team:Panama/8_July_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Team:Panama/9_July_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Team:Panama/10_July_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Team:Panama/11_July_2010&action=edit 11]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/12_July_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Team:Panama/13_July_2010&action=edit 13] [http://2010.igem.org/wiki/index.php?title=Team:Panama/14_July_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Team:Panama/15_July_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Team:Panama/16_July_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Team:Panama/17_July_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Team:Panama/18_July_2010&action=edit 18]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/19_July_2010&action=edit 19] [http://2010.igem.org/Team:Panama/20_July_2010 20] [http://2010.igem.org/Team:Panama/21_July_2010 21] [http://2010.igem.org/Team:Panama/22_July_2010 22] [http://2010.igem.org/Team:Panama/23_July_2010 23] [http://2010.igem.org/Team:Panama/24_July_2010 24] [http://2010.igem.org/wiki/index.php?title=Team:Panama/25_July_2010&action=edit 25]
[http://2010.igem.org/Team:Panama/26_July_2010 26] [http://2010.igem.org/Team:Panama/27_July_2010 27] [http://2010.igem.org/Team:Panama/28_July_2010 28] [http://2010.igem.org/Team:Panama/29_July_2010 29] [http://2010.igem.org/Team:Panama/30_July_2010 30] [http://2010.igem.org/wiki/index.php?title=Team:Panama/31_July_2010&action=edit 31]
August
MTWTFSS
            [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_August_2010&action=edit 1]
[http://2010.igem.org/Team:Panama/2_August_2010 2] [http://2010.igem.org/wiki/index.php?title=Team:Panama/3_August_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Team:Panama/4_August_2010&action=edit 4] [http://2010.igem.org/Team:Panama/5_August_2010 5] [http://2010.igem.org/wiki/index.php?title=Team:Panama/6_August_2010&action=edit 6] [http://2010.igem.org/wiki/index.php?title=Team:Panama/7_August_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Team:Panama/8_August_2010&action=edit 8]
[http://2010.igem.org/Team:Panama/9_August_2010 9] [http://2010.igem.org/Team:Panama/10_August_2010 10] [http://2010.igem.org/Team:Panama/11_August_2010 11] [http://2010.igem.org/Team:Panama/12_August_2010 12] [http://2010.igem.org/Team:Panama/13_August_2010 13] [http://2010.igem.org/wiki/index.php?title=Team:Panama/14_August_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Team:Panama/15_August_2010&action=edit 15]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/16_August_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Team:Panama/17_August_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Team:Panama/18_August_2010&action=edit 18] [http://2010.igem.org/Team:Panama/19_August_2010 19] [http://2010.igem.org/Team:Panama/20_August_2010 20] [http://2010.igem.org/wiki/index.php?title=Team:Panama/21_August_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Team:Panama/22_August_2010&action=edit 22]
[http://2010.igem.org/Team:Panama/23_August_2010 23] [http://2010.igem.org/Team:Panama/24_August_2010 24] [http://2010.igem.org/wiki/index.php?title=Team:Panama/25_August_2010&action=edit 25] [http://2010.igem.org/wiki/index.php?title=Team:Panama/26_August_2010&action=edit 26] [http://2010.igem.org/wiki/index.php?title=Team:Panama/27_August_2010&action=edit 27] [http://2010.igem.org/wiki/index.php?title=Team:Panama/28_August_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Team:Panama/29_August_2010&action=edit 29]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/30_August_2010&action=edit 30] [http://2010.igem.org/wiki/index.php?title=Team:Panama/31_August_2010&action=edit 31]
September
MTWTFSS
    [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_September_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Team:Panama/2_September_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Team:Panama/3_September_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Team:Panama/4_September_2010&action=edit 4] [http://2010.igem.org/Team:Panama/5_September_2010 5]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/6_September_2010&action=edit 6] [http://2010.igem.org/wiki/index.php?title=Team:Panama/7_September_2010&action=edit 7] [http://2010.igem.org/Team:Panama/8_September_2010 8] [http://2010.igem.org/Team:Panama/9_September_2010 9] [http://2010.igem.org/Team:Panama/10_September_2010 10] [http://2010.igem.org/wiki/index.php?title=Team:Panama/11_September_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Team:Panama/12_September_2010&action=edit 12]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/13_September_2010&action=edit 13] [http://2010.igem.org/wiki/index.php?title=Team:Panama/14_September_2010&action=edit 14] [http://2010.igem.org/Team:Panama/15_September_2010 15] [http://2010.igem.org/Team:Panama/16_September_2010 16] [http://2010.igem.org/wiki/index.php?title=Team:Panama/17_September_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Team:Panama/18_September_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Team:Panama/19_September_2010&action=edit 19]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/20_September_2010&action=edit 20] [http://2010.igem.org/wiki/index.php?title=Team:Panama/21_September_2010&action=edit 21] [http://2010.igem.org/Team:Panama/22_September_2010 22] [http://2010.igem.org/Team:Panama/23_September_2010 23] [http://2010.igem.org/Team:Panama/24_September_2010 24] [http://2010.igem.org/wiki/index.php?title=Team:Panama/25_September_2010&action=edit 25] [http://2010.igem.org/wiki/index.php?title=Team:Panama/26_September_2010&action=edit 26]
[http://2010.igem.org/wiki/index.php?title=Team:Panama/27_September_2010&action=edit 27] [http://2010.igem.org/Team:Panama/28_September_2010 28] [http://2010.igem.org/wiki/index.php?title=Team:Panama/29_September_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Team:Panama/30_September_2010&action=edit 30]
October
MTWTFSS
        [http://2010.igem.org/wiki/index.php?title=Team:Panama/1_October_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Team:Panama/2_October_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Team:Panama/3_October_2010&action=edit 3]
[http://2010.igem.org/Team:Panama/4_October_2010 4] [http://2010.igem.org/wiki/index.php?title=Team:Panama/5_October_2010&action=edit 5] [http://2010.igem.org/Team:Panama/6_October_2010 6] [http://2010.igem.org/Team:Panama/7_October_2010 7] [http://2010.igem.org/Team:Panama/8_October_2010 8] [http://2010.igem.org/wiki/index.php?title=Team:Panama/9_October_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Team:Panama/10_October_2010&action=edit 10]
[http://2010.igem.org/Team:Panama/11_October_2010 11] [http://2010.igem.org/Team:Panama/12_October_2010 12] [http://2010.igem.org/Team:Panama/13_October_2010 13] [http://2010.igem.org/Team:Panama/14_October_2010 14] [http://2010.igem.org/Team:Panama/15_October_2010 15] [http://2010.igem.org/Team:Panama/16_October_2010 16] [http://2010.igem.org/wiki/index.php?title=Team:Panama/17_October_2010&action=edit 17]
[http://2010.igem.org/Team:Panama/18_October_2010 18] [http://2010.igem.org/Team:Panama/19_October_2010 19] [http://2010.igem.org/Team:Panama/20_October_2010 20] [http://2010.igem.org/Team:Panama/21_October_2010 21] [http://2010.igem.org/wiki/index.php?title=Team:Panama/22_October_2010&action=edit 22] [http://2010.igem.org/Team:Panama/23_October_2010 23] [http://2010.igem.org/Team:Panama/24_October_2010 24]
[http://2010.igem.org/Team:Panama/25_October_2010 25] [http://2010.igem.org/Team:Panama/26_October_2010 26] [http://2010.igem.org/Team:Panama/27_October_2010 27] [http://2010.igem.org/wiki/index.php?title=Team:Panama/28_October_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Team:Panama/29_October_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Team:Panama/30_October_2010&action=edit 30] [http://2010.igem.org/wiki/index.php?title=Team:Panama/31_October_2010&action=edit 31]