Team:ESBS-Strasbourg/Results/Biobricks

• PIF3
• PIF6
• PHY B 900
• PHY B 650
• ∆N-ClpX
• linker
• LAA Tag
• DAS Tag
• Lambda Tag
• GFP (super fold)
• PhyB642-(linker-∆NClpX)3
• PhyB908-(linker-∆NClpX)3
• Full-length ClpX
• ∆NClpX-linker-∆NClpX-linker-∆NClpX
• (linker-∆NClpX)3

other link if needed

      

Part Number:	Part Name:	Plasmid/Resistance	Status
BBa_K365000	Phytochrome Interacting Factor-3 (PIF3)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365001	Phytochrome Interacting Factor-6 (PIF6)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365002	Phytochrome B (aa 1-908)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365003	Phytochrome B (aa 1-642)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365004	∆N-ClpX (aa 61-425)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365005	Linker (aa 20)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365006	LAA tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365007	DAS tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365008	Lambda tag	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365009	GFP (super fold)	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365010	PhyB642-(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Not yet Sequenced
BBa_K365011	PhyB908-(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Not yet Sequenced
BBa_K365012	Full-length ClpX	pSB1C3 / Chloramphenicol	Sequenced
BBa_K365013	∆NClpX-linker-∆NClpX-linker-∆NClpX	pSB1C3 / Chloramphenicol	Not yet Sequenced
BBa_K365014	(linker-∆NClpX)3	pSB1C3 / Chloramphenicol	Not yet Sequenced

Background:

PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.

Conception:

The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 (Lim & Voigt, 2009.)
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.

There is no PDB structure for the PIF3
The stucture below is modeled by homology using the server I-TASSER
The plasmid containing the PIF3-sequence was provided by the laboratory of Stephan Kircher from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 51 bp
GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC

Reverse primer (5’->3’): 51 bp
ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC

In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’) (24 bp)
GCAAACTCTTCAAGAGCTAGAGAG

Reverse primer (5’->3’) (24 bp)
CTCTCTAGCTCTTGAAGAGTTTGC

Background:

For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, (Lim & Voigt, 2009.) screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to coexpressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane.

Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF
pairs in a fluorescence translocation assay.

Conception:

We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by (Lim & Voigt, 2009.).

There is no PDB structure for the PIF6
The stucture below is modeled by homology using the server I-TASSER

The plasmid containing the PIF6-sequence was provided by the laboratory of Wilfried Weber from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 54 bp
GGATCCgaattcgcggccgcttctagatggccggcATGATGTTCTTACCAACCG

Reverse primer (5’->3’): 58 bp
CAGCTGctgcagcggccgctactagtattaaccggtGTCAACATGTTTATTGCTTTCC

Background:

Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB (Khanna et al., 2004). The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm).

The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.

Conception:

In in-vivo applications it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light. Lim & Voigt (2009) demonstrated by assaying PIF6 (which has the strongest interactions of all previously reported PIF domains) against different variants of PhyB that the tandem C-terminal PAS domains (residues 1-908)of plant phytochromes are necessary to confer rapid photoreversibility under infrared light. The original sequence contains a SpeI restriction within the first 908 residues.



The plasmid containing the PhyB-sequence was provided by the laboratory of Wilfried Weber from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.

Forward primer (5’->3’): (41bp)
GGATCCgaattcgcggccgcttctagATGGTTTCCGGAGTC

Reverse primer (5’->3’): (52 bp)
CAGCTGctgcagcggccgctactagtattaaccggtGCTCGGGATTTGCAAG

In order to get a sequence without an internal restriction sites of one of the BioBrick standards theSpeI-restriction site was altered without changing the encoded amino acid (ACT=Threonine (AC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’): (28 bp)
GGACAAGACGTTACGAGTCAGAAAATCG

Reverse primer (5’->3’): (27 bp)
CGATTTTCTGACTCGTAACGTCTTGTC

Background:

Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB (Lim & Voigt 2009). The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm).

The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it was fused to the N-teminal of the ClpX-trimer.

Conception:

As mentioned before it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light in in vivo-application (Lim & Voigt 2009). Nevertheless, the binding strength and kinetic parameters depend on the composition and nature of the individual system, so we decided to include also this shorter variant of PhyB in our tests.



The plasmid containing the PhyB-sequence was provided by the laboratory of Wilfried Weber from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.

Forward primer (5’->3’): (42 bp)
GGATCCgaattcgcggccgcttctagATGGTTTCCGGAGTC

Reverse primer (5’->3’) : (53 bp)
CAGCTGctgcagcggccgctactagtattaaccggtCCCCGCCATATCCCTAC

Background

ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.

Conception

ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides.

The sequence was obtained from the following database for DH5α E.coli cells:

1- http://www.ncbi.nlm.nih.gov/gene/945083

2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts

Problem: 2 AgeI and 2 EcoRI sides

Primers for cloning ClpX out of the E.Coli genome.
These primes were used to amplificate ClpX from the E.coli genome.

Forward primer (5’->3’) : 31bp
CGCAGTGCGCTACCGACGCCGCATGAAATTC

Reverse primer (5’->3’) : 32bp
TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC

Primers for Pfu-mutagenese

1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)       AgeI site

Forward primer (5’->3’) (31 bp)
CTGATCGGTCCGACTGGTTCCGGTAAAACGC

Reverse primer (5’->3’) (29 bp)
GCGTTTTACCGGAACCAGTCGGACCGATCAG

2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)       EcoRI site

Forward primer (5’->3’) (28 bp)
CATCCGCAGCAGGAGTTCTTGCAGGTTG

Reverse primer (5’->3’) (28 bp)
CAACCTGCAAGAACTCCTGCTGCGGATG

3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)       EcoRI site

Forward primer (5’->3’) (25 bp)
CGTGGATCTGGAGTTCCGTGACGAG

Reverse primer (5’->3’) (25 bp)
CTCGTCACGGAACTCCAGATCCACG

4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)       AgeI site
Forward primer (5’->3’) (24 bp)
GGCGCGTAAAACTGGTGCCCGTGG

Reverse primer (5’->3’) (24 bp)
CCACGGGCACCAGTTTTACGCGCC

Primers for amplification of ClpX with fusion pre- and suffix
After mutagenesis of internal restriction sides, the fusion pre- and suffixes were added to the ClpX gene.

Forward primer (5’->3’):
NNNNNNgaattcgcggccgcttctagatggccggcCGCAGTGCGCTACCGACGCCGC

Reverse primer (5’->3’):
NNNNNNctgcagcggccgctactagtattaaccggtTTCACCAGATGCCTGTTGCGC

Background:

The linker biobrick is used to join the three ClpX subunits covalently in order to build a ClpX trimer and to link the degradation tags and PIF3/6 with the protein destined for degradation.

Conception:

We chose to use the same linker, which was already successfully used by Baker and Sauer (2009) to construct the ClpX trimer. It is a twenty amino acid linker (ASGAGGSEGGGSEGGTSGAT). The codon usage of E. coli (http://www.geneinfinity.org/sp_codonusage.html) has been used to decide the DNA sequence, in addition RFC 25 fusion prefix and suffix have been added to the sequence.



The linker has been order as six separate, EcoRI+AgeI precut primers, which were hybridized in order to obtain the complete linker sequence.

Forward strand (5’->3’) : (89 bp)
aattcgcggccgcttctagatggc|cggcGCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG|CGAAGGCGGCACCAGCGGCGCGACCa

Reverse strand (5’-3’) : (89 bp)
ccggtGGTCGCGCCG|CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC|GCCCGCGCCGCTCGCgccggccatctagaagcggccgcg

Ordered primer:

Forward:         5’aattcgcggccgcttctagatggc 3’

Forward:         5’cggcGCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG 3’

Forward:         5’CGAAGGCGGCACCAGCGGCGCGACCa 3’

Reverse:          5’ccggtGGTCGCGCCG 3’

Reverse:          5’CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC 3’

Reverse:          5’GCCCGCGCCGCTCGCgccggccatctagaagcggccgcg3’

Background:

LAA tag is a C-terminal region of the natural ssrA-recognition sequence of E. Coli that interacts with the ClpXP protease. A protein fused with this tag will be preferentially degraded by the ClpX protease without need of an adaptor protein Baker and Sauer (2006). This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.

Conception:

We chose to use the same tag, which was already successfully used by used by Baker and Sauer (2006). It is a eleven amino acid tag (AANDENYALAA). At the end of the coding sequence a double stop codon was added (ACTAGT). The codon usage of E. coli (http://www.geneinfinity.org/sp_codonusage.html) has been used to decide the DNA sequence and NgoMIV and Pst1 restriction sites have been added to the sequence.

The linker has been order as two separate, NgoMIV + Pst1 precut primers, which were hybridized in order to obtain the complete tag sequence.

LAA Tag

Ordered primer

Forward:         5’CCGGCGCGCTGGCGGCGTAATAATACTAGTAGCGGCCGC3’

Reverse:          5’ TGCAGCGGCCGCTACTAGTATTATTACGCCGCCAGCGCG 3’

For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake.

Background:

The DAS tag presents a C-terminal recognition sequence that has been artificially altered so that it has weakened interactions with ClpXP and depends on an adaptor Baker and Sauer (2006). In E. coli, the adaptor SspB tethers specifically tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In our system, the role of the adaptor-protein SspB has been assumed by Pif3/6. So only light-induced activation can lead to binding and efficient degradation of DAS+4 bearing constructs.

Conception:

We decided to use the same tag, which was already successfully used by Baker and Sauer (2006). It is a eleven amino acid tag (AANDENYADAS). At the end of the coding sequence a double stop codon was added (ACTAGT). The codon usage of E. coli (http://www.geneinfinity.org/sp_codonusage.html) has been used to decide the DNA sequence, in addition NgoMIV and PST1 restriction sites have been added to the sequence.

The linker has been order as two separate, NgoMIV + Pst1 precut primers, which were hybridized in order to obtain the complete linker sequence.



Ordered primer

Forward:         5’ CCGGCGCGGATGCGAGCTAATAATACTAGTAGCGGCCGC3’

Reverse:          5’ TGCAGCGGCCGCTACTAGTATTATTAGCTCGCATCCGCG 3’

For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake.

Background:

The λO- tag is the N-terminal equalent to the DAS tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant.

Baker and Sauer (2009) used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.

Conception:

We chose to use the same sequence, which was already successfully used by used by Baker and Sauer (2009): NH2-TNTAKILNFGR. The codon usage of E. coli (http://www.geneinfinity.org/sp_codonusage.html) has been used to decide the DNA sequence, in addition NgoMIV and AgeI restriction sites have been added to the sequence.

The linker has been order as two separate, NgoMIV + Pst1 precut primers, which were hybridized in order to obtain the complete linker sequence.



Ordered primer

Forward:         5’AATTCGCGGCCGCTTCTAGATGACCAACACCGCGAAAATTCTGAACTTTGGCCGCA 3’

Reverse:          5’CCGGTGCGGCCAAAGTTCAGAATTTTCGCGGTGTTGGTCATCTAGAAGCGGCCGCG 3’

...

...

...

...

...

...

...