"
Team:Panama/13 August 2010
From 2010.igem.org
(Difference between revisions)
Nikkibiotech (Talk | contribs) (→August 13) |
Nikkibiotech (Talk | contribs) (→August 13) |
||
| Line 55: | Line 55: | ||
First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM. | First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM. | ||
| - | [[Image:PCR0.4.jpg| | + | [[Image:PCR0.4.jpg|150px|thumb|left|alt text]] |
| Line 61: | Line 61: | ||
| - | [[Image:PCR0.5.jpg| | + | [[Image:PCR0.5.jpg|150px|thumb|left|alt text]] |
| Line 67: | Line 67: | ||
| - | [[Image:PCR1.1.jpg| | + | [[Image:PCR1.1.jpg|150px|thumb|left|alt text]] |
| Line 75: | Line 75: | ||
[[Image:Cuadro_13_agosto3.jpg|400px|thumb|left|alt text]] | [[Image:Cuadro_13_agosto3.jpg|400px|thumb|left|alt text]] | ||
| - | |||
| - | |||
Revision as of 00:03, 26 October 2010
August 13
Digestion Reaction
Now that we have our Rh1ab we are going to run a PCR of it using our first set of primers.
RhT-F1a 5' GCGATAGCTGTTTGCCTGTT 3'
RhT-R2a 5' TGGCAACCCTATCTGTTATGC 3'
First of all, we have to resuspend our primers since they come in a lyophilized manner. We need a stock solution of 100uM. Our working solution has a concentration of 10uM.
We tested three concentrations of primers to see which one worked better for us and we can see that all three concentrations worked! So from now on, just to be on the safe side, we're going to use the concentration of 1uM.
|
|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
